Skip to main content
Addgene
Showing: 1 - 1 of 1 results
  1. Sequencing Primers

    Type
    Guide
    ... For sequencing plasmids in our repository, we've chosen primers based on the plasmid backbone and insert...uses for sequence verification of deposited plasmids. Plasmid... Plasmid Reference Molecular Biology Reference Sequencing... useful in your sequencing reaction, find your plasmid page and see what primers are listed under "5' ... for sanger sequence verification of deposited plasmids. Below is a list of commonly used primers. This...forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT...GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT ...
Showing: 1 - 1 of 1 results