...forward primer pRS-marker CGGCATCAGAGCAGATTGTA To sequence yeast selectable marker in pRS vectors Pry1...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

... many lentiviral genomes have selectable markers, such as the puromycin resistance gene, conferring antibiotic...not have selectable markers conferring resistance to an antibiotic, but do encode another marker, such as...Protocols Publications Retroviral integration site selection. Desfarges S, Ciuffi A. Viruses. 2010. Jan;2(1...