Addgene

Addgene Website Feedback

Need help? Send us an email at [email protected] Privacy Policy

Holiday Schedule: Addgene will be closing at 1:00 pm EST on November 27th and remain closed through the 29th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].

This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

How are we doing? Share feedback for a chance to win $50

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Search

Search

Search
Log In
Create Account
Track Order

By Type
Plasmids
Viral Service
Antibodies
Pooled Libraries
Plasmid Kits

By Viral Service
About Our Viral Service
In-Stock AAV
- Function
- Biosensors
- Chemogenetics
- Controls
- Optogenetics
- Recombinases
- Engineered Serotypes
- Caltech Systemic
- Retrograde
- University of Florida Eye Panel
- View all AAV
In-Stock Lentivirus

By Plasmid Category

COVID-19
Genome Editing
- CRISPR
- Cre-lox
- TALENs
- Zinc Fingers
Viral Plasmids
Luminescence
- Fluorescent Proteins
- Luciferase
Chemogenetics & Optogenetics
- Chemogenetics
- Optogenetics

Cloning & Engineering
Model Systems
- Microbes
- Plants
- Worm
- Zebrafish
Research Fields
- Cancer
- COVID-19
- Immunology
- Stem Cells
Pathways & ORFs
Communities
Available to Industry

Depositing with Addgene
Benefits of Depositing Plasmids
Depositor Testimonials
Rewards Points
Pre-Publication Depositing

Start your Deposit
Deposit Overview
Submit Online Deposit
Download Deposit Spreadsheet

Need Help?
Deposit Process Guide
Deposit Help Center Articles
Email [email protected]

Educational Resources

Blog
eBooks
Molecular Biology Basics
Protocols
View all Educational Resources

Recipient Instructions
Science Guides
Videos

Tools

Data Hub
Learn about AAV and antibody materials from user-contributed reports
Sequence Analyzer
Analyze a DNA sequence to see restriction sites and map
Vector Database
Browse a digital-only collection of vector backbone information

Ordering & MTAs
How do I place an order? Does Addgene accept orders by fax, phone or email?
What is an MTA/Who is authorized to sign?
How do I get a quote?
What do I need to know about the customs and importation process for my country?
View all Ordering & MTA articles

Technical Support
Can you help me find a plasmid?
There is a problem with the plasmid I received.
My stab did not grow. What do I do?
What strain of bacteria does my stab contain?
How can I be notified when a plasmid from a specific lab or paper is available?
What services does Addgene provide?
View all Technical Support articles

Depositing Plasmids
How do I prepare and deposit my plasmids?
Which plasmids should I deposit?
How can I track requests for my plasmids?
What are Rewards Points?
View all Depositing Plasmids articles

Viral Preps & Antibodies
What is virus associated DNA, and why do I have to order it?
What virus titer will I receive?
Viral storage
Antibody storage
View All Viral Preps & Antibodies articles

Plasmid Handling
Bacterial stab
DNA
Pooled library
Kit
Plasmid verification
View all Plasmid Handling articles

Technology Transfer
Resources for your Tech Transfer Office

Access the Help Center
View all Help Center articles

We narrowed to 1 result for: pBabe

In Category

Catalog

Blog Posts
Collections
All

Showing: 1 - 1 of 1 results

Sequencing Primers

Type

Guide

...forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, ...pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC (Weinberg Lab) SV40 enhancer, 3' of MCS in pBABE vectors, reverse...reverse primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of MCS in pBABE vectors, ...