...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...increased efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

...plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity...of interest could be inserted upstream of the luciferase gene to determine the level of transcription ...