...Packaging genes (viral Gag-Pol): Gag is a structural precursor protein, and Pol is a polymerase. Envelope gene...use the same gene products for packaging (i.e., Gag, Pol, and Env), the isoforms of these proteins, as ...utilizes a packaging cell line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these... developed by Garry Nolan at Stanford contains Gag-Pol and either an ecotropic envelope, Phoenix-ECO, ...days. Another variant, Phoenix-gp, contains only Gag-Pol and enables additional flexibility in pseudotyping...lentiviruses and standard γ-retroviruses use the Gag, Pol, and Env genes for packaging; however, they are...protein; Pseudotyped to alter infectivity. Packaging Gag in trans Precursor structural protein of the retroviral...

...Plasmid All on one plasmid: Gag, Pol, Rev, Tat Two plasmids: one encoding Gag and Pol and another encoding Rev...contains a single packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains... plasmids: one encoding Rev and one encoding Gag and Pol. Although safer, this system can be more cumbersome... generation packaging systems: express the HIV gag, pol, rev, and tat genes all from a single packaging... . 3rd generation packaging systems: express gag and pol from one packaging plasmid and rev from another...lentiviruses and standard retroviruses use the gag, pol, and env genes for packaging; however, they are... to drive RNA pol III-directed transcription of shRNAs. cDNA expression requires RNA pol II, and thus ...

...Glutamine Gln Q CAA, CAG Glutamic Acid Glu E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H ...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates.... During replication, DNA unwinds and the DNA polymerase enzyme binds to and migrates down the single ...replication requires the 4 nucleotides, a DNA polymerase enzyme, the template DNA to be copied, and a ... DNA and acts as a starting point for the DNA polymerase. Thus to replicate a piece of DNA in vitro one...

..., reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward...TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 ...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...

...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...