Skip to main content
Addgene
Showing: 1 - 4 of 4 results
  1. Sequencing Primers

    Type
    Guide
    ...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer...reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...
  2. Lentiviral Guide

    Type
    Guide
    ... hybrid LTR promoter (more information on this below). Additional or specialized promoters may also be...internal promoter is provided, gene expression is driven by the 5'LTR, which is a weak promoter and requires...heterologous promoter on the transfer plasmid. Expression of the transgene from this promoter is no longer... and fused to a heterologous enhancer/promoter such as CMV or RSV Return to Top Viral Production The process...pol II, and thus requires an RNA pol II promoter, such as CMV or RSV. What techniques can be used to clone... use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...generation lentiviral plasmids utilize the viral LTR promoter for gene expression, whereas 3rd-generation transfer...
  3. Promoters

    Type
    Guide
    ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream.... Common Eukaryotic Promoters Used in Research Promoter Expression Description CMV Constitutive Strong...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...
  4. Plan Your Experiment

    Type
    Guide
    ...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...activator (such as dCas9-VP64) gRNA(s) targeting promoter elements of target gene Many different activators...dCas9-repressors, gRNAs should be targeted to the promoter driving expression of your gene of interest. For...
Showing: 1 - 4 of 4 results