... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...EtOH) 25 µg/mL Hygromycin B 200 mg/mL 200 µg/mL Kanamycin 50 mg/mL 50 µg/mL Spectinomycin 50 mg/mL 50 µg...

...MCS for cloning X gene, an S V40 promoter, and N eomycin selection. Return to Top Glossary Plasmid Type ...

... genomes have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...