Skip to main content
Addgene
Showing: 1 - 12 of 12 results
  1. CRISPR Guide

    Type
    Guide
    ... catalyze cytidine deamination instead of (or in addition to) adenosine deamination, producing cytosine...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...interesting adaptive immune response that detects and eliminates foreign DNA, which scientists have modified for...target sequence present in the gRNA. CRISPR was originally employed to knock out target genes in various...SpCas9, has one active nuclease domain and one inactivated one, allowing it to generate DNA nicks by cutting...cutting only one strand. Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects xCas9...
  2. Molecular Biology Reference

    Type
    Guide
    ... codon combinations each amino acid is encoded for by multiple codons. Plasmids and Recombinant DNA Technology...field of recombinant DNA, in which many identical DNA fragments can be generated. The combination of a DNA...chromosomes, which are composed of DNA. These findings culminated in the central dogma of molecular biology, that...This obstacle has been overcome by the field of recombinant DNA technology, which enables the preparation... reference to any extrachromosomal heritable determinant. Plasmids are fragments of double-stranded DNA...a plasmid or vector DNA backbone generates a recombinant DNA molecule, which can be used to study DNA ...fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids that are used ...
  3. Cloning

    Type
    Guide
    ...Stitching Molecular cloning or the creation of recombinant DNA is an essential process used in scientific... most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction enzyme... Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid ...101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of Gateway...one plasmid into another is done via a single recombination reaction, drastically simplifying the process...plasmid must already be surrounded by specific recombination sites (in this regard, not so dissimilar from...rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase...
  4. Lentiviral Guide

    Type
    Guide
    ...insert to recombine with the destination vector (in this case the destination vector would be the lentiviral...interest. The transgene sequence is flanked by long terminal repeat (LTR) sequences, which facilitate integration...deletion in the 3'LTR, rendering the virus “self-inactivating” (SIN) after integration. Packaging plasmid(...addition of one additional plasmid. Second, Tat is eliminated from the 3rd generation system through the addition... always SIN: Uses 4 plasmids instead of 3 and eliminates the requirement for Tat. LTR Viral Promoter Wild...used to transduce the cells of interest. For determination of viral titer and full details, see the (Link...producing my lentiviral plasmids? Due to the long terminal repeats found in lentiviral plasmids, we recommend...
  5. Adenovirus Guide

    Type
    Guide
    ...in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then... other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized...transcripts. At either end of the genome are i nverted t erminal r epeats (ITRs). Genes are divided into early (...Coxsackie-Adenovirus Receptor (CAR) to enter cells. Recombinant adenovirus has two genes deleted: E1 and E3. ...left and right arms to facilitate homologous recombination of the transgene into the adenoviral plasmid...right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid...single-stranded DNA parvovirus and was discovered as a contaminant of adenovirus preparations, whereas adenoviruses...
  6. Antibody Guide

    Type
    Guide
    ...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids... and can either be used while suspended in the original media or isolated and placed in a buffer. Antibody... binding site. This process, known as V(D)J recombination, allows for a wide variety of antibodies to ...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...
  7. Optogenetics Guide

    Type
    Guide
    ... BL 2012. Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression...delay the closing of the channel 470(activ.), 590(inact.) ReaChR Red-activatable variant of CrChR2 590 Channelrhodopsins...chloride pump from Haloarcula (Halobacterium) salinarum (strain Shark), used to silence neuronal activity...short or long periods of neuronal activation/inactivation periods. These can range from msec (hChR2) to...expression of the opsin and the area that is being illuminated. There are several different ways to control ...especially powerful when combined with site specific recombinase technology like Cre-lox, which allows you to ...one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1,...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... Rep and Cap, flanked by two 145 base inverted terminal repeats (ITRs). These ITRs base pair to allow ...is necessary for lytic cycle activation. When recombinant AAV (rAAV) is used for research purposes, the...the Rep protein is supplied in trans , eliminating the ability of rAAV to integrate into its preferred ...AAV8 Photoreceptor Cells AAV2, AAV5, AAV8 RPE (Retinal Pigment Epithelium) AAV1, AAV2, AAV4, AAV5, AAV8...spontaneously annealing, upon infection, which eliminates the requirement for host cell DNA synthesis. ...increasing packaging capacity depends on homologous recombination. In this method, a gene is divided between two...sequence overlap. Co-expression induces homologous recombination and expression of the full-length transgene ...
  9. Sequencing Primers

    Type
    Guide
    ...T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator, reverse primer Tac promoter ...GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC ...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen...Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD... GTGGTTTGTCCAAACTCATC (Invitrogen) SV40 polyA terminator, reverse primer Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC...hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC ...
  10. Retrovirus Guide

    Type
    Guide
    ...interest: The transgene sequence is flanked by long terminal repeat (LTR) sequences, which facilitate integration...line that stably expresses Gag-Pol and/or Env, eliminating the need to deliver these genes in trans by specific...feature may be useful for the transduction of terminally differentiated (non-dividing) cells. Both lentiviruses... only in lentivirus. Are γ-retroviruses self-inactivating (SIN)? They can be. Plasmids that encode SIN...export. LTR Subcomponents: U3 R U5 in cis LTR; Long terminal repeats; U3-R-U5 regions found on either side ...U5 and the rest of the provirus. 3' LTR in cis Terminates transcription started by 5' LTR by the addition...
  11. Promoters

    Type
    Guide
    ...transcription factors bind. Distal Promoter The final portion of the promoter region is called the distal...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...Plasmids 101: Repressible Promoters Plasmids 101: Terminators and PolyA signals...
  12. Chemogenetics Guide

    Type
    Guide
    ...optogenetics workflows (such as laser or LED illumination), making LMOs a versatile option. Coupling brighter...Suhara T, Takada M, Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective...
Showing: 1 - 12 of 12 results