...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...

...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...

...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system - co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...genetic modification ). Browse Plasmids: Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...Loci Using Fluorophores CRISPR imaging has numerous advantages, including the simplicity of gRNA design...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...

...DNA that already has restriction sites on either side of it into any plasmid that has the same sites in...plasmids have been made with different promoters, tags and fluorescent proteins. Thus, you can clone your...biology techniques (such as fusing it with different tags, putting it under a variety of promoters and into...clonase (creating an entry clone). The entry clone now has recombined attL sites flanking your DNA fragment ...fragment of interest. Now that your DNA fragment has been cloned into a donor plasmid, it can be rapidly shuttled...into a donor plasmid (or acquire one that already has your gene into it) and then using bacterial recombination..., such as restriction cloning, once your project has been completed via gateway cloning. Back to Top TOPO...

...function. TULIPs Tunable light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding...sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk Blue-light photoreceptor for light-...turning on and off the light source. Optogenetics has been broadly applied to study the physiology of the...channel. ChR2 is preferred over ChR1 because ChR2 has higher conductance at physiological pH and trafficks...Depolarizing) ChR Variants. The optogenetic toolbox has been expanded by scientists through both the identification...heterodimerization can reconstitute the protein. This principle has also permitted the design of synthetic two-part transcription...Phytochrome, cryptochrome, and LOV (light oxygen voltage)-based systems have been used in many experimental...

...such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual...large percentage of DSBs are still repaired by NHEJ. How do you determine that your desired edit has occurred...Cas9-gRNA ribonucleoprotein (RNP) complexes are advantageous due to the transient Cas9 expression. The table...: Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed...

...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...

... generation systems because the packaging vector has been divided into two separate plasmids (resulting... transcription of the full-length virus after it has incorporated into a host cell. The potential for ...practices with regard to lentiviral research. The NIH has additional information on lentiviral safety considerations...the transfer vector during the viral production stage. Many of the lentiviral transfer vectors that have...Flap. Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P. Cell. 2000. 101(2): 173-185. PubMed...

...Addgene. The popular CRISPR/Cas9 genome editing system has been modified for use with AAV; this system represents...expression in non-dividing cells and is a key advantage of rAAV. AAV Serotypes Eleven serotypes of AAV...