...type I Cas effector, composed of several separate Cas enzymes that form a complex called Cascade (see Cas3...Base Editing with CRISPR CasPEDIA: A Functional Classification of Cas Enzymes Cas Enzymes and PAM Sequences...application. Cas9 Orthologs While SpCas9 is the most commonly used Cas enzyme, additional Cas9 orthologs ...editing with Cas3 Browse Plasmids: Cascade-Cas3 Want more information on the wide variety of Cas enzymes? ...from. Many variations of Cas9 exist, along with other Cas enzymes like Cas12a, which are available for...paired with the appropriate Cas enzyme. Specific enzymes, such as Cas12a or Cas13 , can improve multiplexing...Other natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9 (from Neisseria...

...Species of Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and...compatible with smaller Cas enzymes) Transient or stable expression of SaCas9 and/or gRNA Infects dividing...sequence, you may want to consider alternative Cas enzymes ( see Cas9 variants and PAM sequences ). Once possible... exon or essential protein domains High-fidelity Cas enzymes increase specificity. Dual-nickase approach...of System Application Mammalian expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha...specificity, you can also consider using a high-fidelity Cas enzyme. In addition to off-target activity , it is...Once you have successfully delivered the gRNA and Cas enzyme to your target cells, it is time to validate...

...hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al., 2007 ...1670767 (Link opens in a new window) Tung JK, Gutekunst CA, Gross RE. (2015). Inhibitory luminopsins: genetically-encoded...

...Methods. 9(2):159-72. PMID 22179551 Saunders A, Johnson CA, Sabatini BL 2012. Novel recombinant adeno-associated...thus expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated...

... of Gateway cassette, forward primer GW-5' AATCTCGCCGGATCCTAACT 5' end of Gateway cassette, reverse primer...beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT (Vosshall lab) 5' end of ...of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of...

...the plasmids to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA ... Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence those...information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources . Check out ...popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries Enable Genome-Scale,...

...is an oncogene) and should be considered on a case by case basis. Biosafety should always be considered...DNA. However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB survival strain...to recombine with the destination vector (in this case the destination vector would be the lentiviral transfer...

...expression. Monoclonal antibodies are necessary in cases where extreme specificity is important. Their epitope...when epitope specificity is not a concern or in cases where you may want to identify or collect the protein...azide, as it acts as an inhibitor to HRP. In those cases, thimerosal can be used as an antimicrobial agent... using the above process and try again. In some cases, it may be preferable to buy small aliquots of many...

...plasmids available from Addgene. The popular CRISPR/Cas9 genome editing system has been modified for use ...use in AAV, or containing Staphylococcus aureus (SaCas9) . AAV is also a promising method for gene therapy...

...promoters and into backbones with different selection cassettes). Although gateway cloning is a simple and efficient...