Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 9 of 9 results
  1. Cre-lox system

    Type
    Collection
    ...recombinase recognizes 34 bp loxP sites, and the orientation and location of the loxP sites determines how the... putting the loxP sites on either side of a gene (called “floxing”, for “flanked by loxP”), will permit...IRES-EGFP Mammalian Costantini 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE Cre activates your gene fused...more colors. Mammalian Zeng 24334 hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible reporter... reporter Lentiviral Geijsen 65726 pLV-CMV-LoxP-DsRed-LoxP-eGFP Switches from DsRed to eGFP expression...expression Mammalian Green 32145 pJFRC172-10XUAS-loxP>-dSTOP-loxP>-myr::GFP Cre dependent myr-GFP expression...recombinases that recognize specific mutant loxP sites, VloxP and SloxP sites respectively. Split Cre: Cre recombinase...
  2. Retrovirus Plasmids

    Type
    Collection
    ...puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression...
  3. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...Flp recombinases to remove genes flanked by either loxP or frt sites respectively, and empty vectors to ...
  4. Zhang Lab CRISPR Page

    Type
    Collection
    ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination and fluorescence assisted sorting ...2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination and fluorescence assisted sorting ...
  5. Zebrafish Plasmid Collection

    Type
    Collection
    ...Eisenhoffer Lab. An optogenetically controlled Cre/loxP system that enables precise temporal and spatial...
  6. Validated gRNA Sequences

    Type
    Collection
    ...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S...
Showing: 1 - 9 of 9 results