...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...modifications, researchers have fused catalytically dead dCas9 to epigenetic modifiers. Design your gRNA to target...histone demethylation by LSD1 cytosine methylation by DNMT3A or MQ1 cytosine demethylation by Tet1 These modifications...

...PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional repressor peptide...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors... CRISPR Blog Posts Base Edit Catalytically dead dCas9 fused to a cytidine deaminase protein becomes a ...Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional activator peptide can...specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your... separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene... separate gRNA expression plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene...

...Chen pdCas9-DNMT3A-EGFP 71666 Mammalian U6 yes, methylation S. pyogenes EGFP Zoldos pdCas9-DNMT3A-PuroR...separate accessory pack is available for dCas9 and FokI-dCas9. Yamamoto Multiplex CRISPR/Cas9-based genome...vector Mammalian Lentiviral expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent...Mammalian S. pyogenes Neo, mCherry Postovit pdCas9-DNMT3A-PuroR_v2 74407 Mammalian U6 yes, methylation...Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors...Mammalian U6 yes, nick S. pyogenes Conklin pXFokI-dCas9 60901 Mammalian U6 yes, FokI S. pyogenes Conklin...Mammalian U6 none S. aureus Joung pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro 71236 Mammalian/Lentiviral hU6 yes...

...achieved by using orthogonal dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent...human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly to a single...imaging of proteins in living cells (Figure 9B) dCas9-VPR - dCas9 fused to several different activation domains...Jonathan Weissman labs , is an all-in-one dCas9 fusion with KRAB, DNMT3A, and DNMT3L. CRISPRoff maintains gene...utilizes biotin tagging of dCas9 by fusing a biotin acceptor site to dCas9 and co-expressing BirA biotin... defense CRISPRa CRISPR Activation; using a dCas9 or dCas9-activator with a gRNA to increase transcription...target gene CRISPRi CRISPR Interference; using a dCas9 or dCas9-repressor with a gRNA to repress/decrease transcription...

...Sabatini DNMT3A H. sapiens GAGATGATCGCCCCTTCTTC 41822 cut S. pyogenes 23287722 Church DNMT3A H. sapiens...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...