Skip to main content
Addgene
Showing: 1 - 8 of 8 results
  1. Genetic Code Expansion

    Type
    Collection
    ...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced...ATMY4 Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA...ATMY5 Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA...TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M. jannaschii tyrosine Bacterial TAG Jeffrey Barrick...1R26PylRS(CbzK)_AfTyrRS(p-I-Phe)_AlvtRNA-ΔNPyl(8)(CGA)_AftRNA-Tyr(A01)(CUA) 1R26PylRS and AfTyrRS CbzK and ...218771 ATMY3 Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tRNA variant...
  2. Validated gRNA Sequences

    Type
    Collection
    ...23995389 Goldstein tyr D. rerio CCCCAGAAGTCCTCCAGTCC 46761 cut S. pyogenes 23918387 Chen tyr D. rerio GGACTGGAGGACTTCTGGGG... Chen Tyr (albino) R. norvegicus TTTCCAGGATTATGTAATAG 60966 cut S. pyogenes 24967838 Mashimo Tyr (wild...
  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ... 10 APO2L, Apo-2L, CD253, TL2, TRAIL TYROBP TYRO protein tyrosine kinase binding protein DAP12, KARAP,...VEGFR1 FLT3 fms-related tyrosine kinase 3 CD135, FLK2, STK1 FLT3LG fms-related tyrosine kinase 3 ligand FL ...MGC111051, SLP-65, SLP65 BTK Bruton agammaglobulinemia tyrosine kinase AGMX1, AT, ATK, BPK, IMD1, MGC126261, MGC126262..., PKC-beta, PKCB, PRKCB1, PRKCB2 PTPN6 protein tyrosine phosphatase, non-receptor type 6 HCP, HCPH, HPTP1C...homolog A (avian) MGC131774, NFKB3, p65 SYK spleen tyrosine kinase DKFZp313N1010, FLJ25043, FLJ37489 VAV1 ...VEGFD FIGNL2 fidgetin-like 2 - FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular...FL FLT4 fms-related tyrosine kinase 4 FLT41, LMPH1A, PCL, VEGFR3 FPR1 formyl peptide receptor 1 FMLP, FPR...
  4. Ras Pathway

    Type
    Collection
    ...oncogene homolog 3 ALK Anaplastic lymphoma receptor tyrosine kinase ARHGAP35 Rho GTPase activating protein ...factor 4E binding protein ERBB2 Erb-b2 receptor tyrosine kinase 2 ERK MAPK1 MAPK3 Also known as MAPK; Mitogen-activated...Fibroblast growth factor receptor FLT3 Fms related tyrosine kinase 3 FNT FNTA FNTB Farnesyltransferase, CAAX...kinase kinase MET MET proto-oncogene, receptor tyrosine kinase MLST8 MTOR associated protein, LST8 homolog...protein kinase ROS1 ROS proto-oncogene 1, receptor tyrosine kinase RPS6KA RPS6KA1 RPS6KA2 RPS6KA3 RPS6KA6 ...
  5. Cre-lox system

    Type
    Collection
    ...PGK Lentiviral Torok-Storb 99249 pVAX1/mTyr-Cre Cre Tyrosinase Mammalian Blank 101242 pSin wPGK-Cre low-efficiency...
  6. Zhang Lab CRISPR Page

    Type
    Collection
    ...cytomegalovirus (CMV, PX601 [#61591] ) or liver-specific tyroxine binding globulin (TBG, PX602 [#61593] ) promoter...
  7. CRISPR Guide

    Type
    Collection
    ...Rodríguez, T. C., Stan, T., Tysinger, E., Hong, L., Yudistyra, V., Ponnapati, M. R., Jacobson, J. M., Church...
Showing: 1 - 8 of 8 results