... CRISPR flyCRISPR Lab CRISPR Plasmids flyCRISPR Plasmids Available from Addgene... Wildonger Lab - O'Connor-Giles Lab email: flycrispr@gmail.com We have found that a variety of Cas9...Resources: Protocol for generating gRNAs 106.5 KB flyCRISPR website contains additional information CRISPR...

...Single polycistronic lentiviral vector for the expression of human Oct4, Sox2, and Klf4 Polycistronic lentiviral...27(5):1042-9. Townes Lentivirus Human Single polycistronic lentiviral vector for the expression of human...(8):1221-9. Cibelli Lentivirus Human Single polycistronic, doxycycline-inducible lentiviral vector for...Non-integrating mini-intronic plasmid (MIP) polycistronic expression of human Oct4, Klf4, Sox2, c-Myc ...episome Human Non-integrating EBNA1-mediated polycistronic expression of human Sox2, KLF4, L-Myc, Lin28...Replicating EBNA1 episome Human Non-integrating polycistronic expression of human Oct4, Klf4, Sox2, c-Myc,...episome Human Non-integrating EBNA1-mediated polycistronic expression of human Oct4, Sox2, Myc, Klf4, BCL2L1...

...lower background signals than polyclonal antibodies. However, polyclonal antibodies are more sensitive...clone that are specific to a certain epitope, or polyclonal, meaning there are many clones that are specific... antibodies are typically more expensive than polyclonal antibodies. Environmental factors, binding partners...available epitope on your protein of interest. Polyclonal antibodies are typically collected directly from...targeting various epitopes on the same antigen. Polyclonal antibodies are often more environmentally stable...protein in any form it may be present in. However, polyclonals can vary significantly from lot to lot, as immune...consider the following questions: Do you need polyclonal or monoclonal antibodies? Will you be using a...

...-TMEM24 73093 GlycophorinA-CD4d3+4-bio 73094 GlycophorinB-CD4d3+4-bio 73095 GlycophorinE-CD4d3+4-bio 73096... 73096 GlycophorinC-CD4d3+4-bio 73097 CD99-CD4d3+4-bio 73098 CD44-isoform1-CD4d3+4-bio 73099 CR1-isoformB-CD4d3...

...production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-1 cap gene in Sf9 insect cells Kotin 65214...production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-2 cap gene in Sf9 insect cells Kotin 65215...production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-6 cap gene in Sf9 insect cells Kotin 65216...production: Expresses bicistronic AAV-2 rep gene and polycistronic AAV-8 cap gene in Sf9 insect cells Kotin 92307...

...MGC149868, hCS-L CSPG5 chondroitin sulfate proteoglycan 5 (neuroglycan C) MGC44034, NGC CTF1 cardiotrophin 1...MGC99678 GPHA2 glycoprotein hormone alpha 2 A2, GPA2, MGC126572, ZSIG51 GPHB5 glycoprotein hormone beta ...subunit ADTB3, ADTB3A, HPS, HPS2, PE AZGP1 alpha-2-glycoprotein 1, zinc-binding ZA2G, ZAG B2M beta-2-microglobulin...osteosarcoma viral oncogene homolog AP-1, C-FOS GSK3B glycogen synthase kinase 3 beta - HRAS v-Ha-ras Harvey ...laevis) DAND4, MGC119894, MGC119895, MGC96951 CGA glycoprotein hormones, alpha polypeptide CG-ALPHA, FSHA, ...MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) GIF, GLIF, MMIF MLN motilin...gfg-1 OGFR opioid growth factor receptor - OGN osteoglycin DKFZp586P2421, OG, OIF, SLRR3A OPRD1 opioid receptor...

...pOpen-UDG UDG Uracil DNA glycosylase 165541 pOpen-Fpg Fpg Formamidopyrimidine DNA glycosylase 165550 pOpen-T4 ...pOpen-T4 PGD T4 PGD (T4 pyrimidine DNA glycosylase, aka T4 Endonuclease V) 165540 pOpen-T7EI T7 Endonuclease ...

... single vector. sgRNAs are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes...Gateway recombination-based cloning of complex polycistronic lentiviruses. Can express Cas9 with up to 3 ...

...EAAC1 Rat Mouse IgG2a 206573 Anti-Glycine receptor Alpha3 [N424/45R] Glycine receptor Alpha3 Human Mouse IgG2a... IgG2a 206574 Anti-Glycine receptor Alpha3L [N424/48R] Glycine receptor Alpha3L Human Mouse IgG2a 206575...receptor Mouse Mouse 206774 Glycine receptor Alpha3 scFv [N424/45] N424/45 scFv Glycine receptor Alpha3 Human...

...synthesis, and increases energy production through glycolysis to fuel these energy-intensive processes. mTORC1...associated protein; LST8 homolog GSK3 GSK3A GSK3B Glycogen synthase kinase 3 MDM2 MDM2 proto-oncogene mSin1...

...acceptable. The bulk sorted cells are composed of a polyclonal population exposed to sgRNA-A and sgRNA-B (see...a single reaction. Optimize multiplexing in a polyclonal population ( i.e., bulk sorted cells) before ...

...70660 cut S. pyogenes 26472758 Sabatini ANT1 S. lycopersicum TGTCGTTTATAATTTGTAGA 70019 cut S. pyogenes 26541286...69992 cut S. pyogenes 25155555 Cepko ANT1 S. lycopersicum ACAATTTAATACACCTTTT 70018 cut S. pyogenes 26541286...

... Glypicans are a family of highly conserved proteoglycans crucial for regulating cell signaling during...

...virus particles with the SARS-CoV-2 spike (S) glycoprotein on the envelope surface. Pseudotyped virus particles...

...that increase product purity such as the DNA glycosylase inhibitor (UGI) or the bacteriophage Mu- derived...

...For example, G-deleted rabies lacks the viral glycoprotein (G) gene, which is not required for the transcription...

...nucleoids 164499 EZH2-mEGFP AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP...

...72268 xpress gene of interest from the PGK (phosphoglycerate kinase I) promoter pCDH-CMV4 72284 Express...

...consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing peptide linker (GGSGGS) ...

...17532 pLTR-G 2nd Envelope Expression of VSV-G glycoprotein (Indiana strain). Use with packaging construct...