Skip to main content
Addgene
Showing: 1 - 5 of 5 results

  1. Qi Lab CRISPR Page

    Type
    Collection
    ... pU6-sgGAL4-1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter... pU6-sgGAL4-4 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter...

  2. Worm Expression Resources

    Type
    Collection
    ...Sternberg Lab. Plasmids for the temperature-robust GAL4-UAS system in C. elegans . Synthetic Biology Synthetic...

  3. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...or localization experiments Yeast GAL4, PGK, ADH1, ADE2, TRP1 Gateway destination ...pACT2.2 - Yeast 2-hybrid plasmids Fly UAS, MT Targeted Gene Expression - Rubin... attB site for high expression of UAS-driven transgenes Worm unc-54, variety of worm gene...under the metallothionein promoter pACU2 - Modified pUAST vector containing both P-elements...

  4. Validated gRNA Sequences

    Type
    Collection
    ... Mendenhall GAL4 UAS GAACGACTAGTTAGGCGTGTA 46916 activate S. pyogenes 23849981 Qi GAL4 UAS GTTGGAGCACTGTCCTCCGAACGT...23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC...TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC 64159 activate S. pyogenes...

  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... mCherry 5X UAS Huntington's Pedro Domingos 201249 pUAST alpha-SynWT-EGFP SNCA GFP 5X UAS Parkinson's ... pM-ErbB4CTF ERBB4 GAL4-BD ALS Marius Sudol 17798 pM-ErbB4CTF-PY1 mutant ERBB4 GAL4-BD ALS Marius Sudol...pM-ErbB4CTF-PY3 mutant ERBB4 GAL4-BD ALS Marius Sudol 17800 pM-ErbB4-delta-kinase ERBB4 GAL4-BD ALS Marius Sudol... mutant ERBB4 GAL4-BD ALS Marius Sudol 17802 pM-ErbB4-delta-kinase-PY3 mutant ERBB4 GAL4-BD ALS Marius... 214613 pcDNA3_ERBB4-NTEV-tcs-GV-2xHA ERBB4 TEV, Gal4, VP16, HA CMV ALS Michael Wehr 214672 lucMAPT-30D...
Showing: 1 - 5 of 5 results