...Addgene Zhang Lab CRISPR Resources Tips for and FAQs about the Zhang Lab CRISPRs Browse All Zhang Lab Plasmids... Genome Engineering CRISPR Zhang Lab CRISPR Plasmids Zhang Lab CRISPR Plasmids...sequences Zhang Lab SAM Cloning Protocol 321.5 KB Return to top AAV - In vivo Genome Editing The Zhang Lab ... Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science . 2013 Jan 3. DOI: 10.1126...S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang F. Cell . 2013 Sep 12;154(6):1380-9. doi: 10.1016...Heidenreich M, Xavier RJ, Langer 9, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct...plasmids from the Zhang lab Genome...

...Genome Engineering CRISPR Zhang Lab CRISPR Plasmids Zhang Lab CRISPR FAQs Zhang Lab's CRISPR Frequently ...homology arms. The Zhang lab typically use PAGE purified long oligos. For large changes (>100bp insertions...author of a seminal CRISPR article from Dr. Feng Zhang's Lab, has assembled a list of FAQs about using the...Frequently Asked Questions You may also like... Zhang Lab CRISPR plasmids General CRISPR Plasmids Dr. Le Cong, ...author of one of the seminal articles from Dr. Feng Zhang's Lab ( Science , February 2013 ), has assembled ...about using the lab's CRISPR technology. Visit the Zhang Lab page and forum to learn more. CRISPR Design ...Double nickase' is a new system, developed by the Zhang lab, which has comparable efficiency to the optimized...

...Browse the Zhang lab’s comprehensive human transcription factor collection, available at Addgene. The... Depositor Collections MORF Feng Zhang - Multiplexed Overexpression of Regulatory Factors...Factors (MORF) Collection You may also like... Feng Zhang Lab Plasmids The Human TFome Library Stem Cells ...Gootenberg JS, Fu Z, Macrae RK, Buenrostro JD, Regev A, Zhang F. Cell 2023 Jan 5; 186(1):209-229. PubMed (Link...Description MORF library 137000, 192821, 1000000218 Zhang A collection of human transcription factor open ...

...PMID: 33230293 Yang, S., Zhang, Y., Xu, J., Zhang, J., Zhang, J., Yang, J., Jiang, Y., & Yang, S. (2021)....28931002 Cheng, A. W., Wang, H., Yang, H., Shi, L., Katz, Y., Theunissen, T. W., Rangarajan, S., Shivalila, ...Tian, R., Huang, Z., Jin, Z., Li, L., Liu, J., Huang, Z., Xie, H., Liu, D., Mo, H., Zhou, R., Lang, B., Meng...PMID: 32217751 Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., & Jaenisch...e04766. PMID: 25497837 Ma, Y., Zhang, J., Yin, W., Zhang, Z., Song, Y., & Chang, X. (2016). Targeted AID-mediated... Q., Xie, Z., Bai, M., Dong, R., Tang, W., Xing, Y., Zhang, H., Yang, S., Chen, L., Bartolomei, M. S.,.... You can therefore change the genomic target of the Cas enzyme by simply changing the target sequence...

.... pyogenes EGFP Zhang PX460 (3rd Gen) 48873 Mammalian BbsI yes, nick S. pyogenes Zhang PX458 (3rd Gen).... pyogenes EGFP Zhang PX335 (2nd Gen) 42335 Mammalian BbsI yes, nick S. pyogenes Zhang PX334 (1st Gen).... pyogenes Puro Zhang PX330 (2nd Gen) 42230 Mammalian BbsI yes, cut S. pyogenes Zhang PX260 (1st Gen) ...pyogenes Puro Zhang sgRNA(MS2) cloning backbone 61424 Mammalian BbsI none S. pyogenes Zhang pSpCas9n(BB)...Puro Zhang pSpCas9(BB)-2A-Puro (PX459) V2.0 62988 Mammalian BbsI yes, cut S. pyogenes Puro Zhang phH1-...Puro Zhang lenti sgRNA(MS2)_zeo backbone 61427 Mammalian/Lentiviral BsmBI none S. pyogenes Zhang pL-CRISPR.EFS.GFP...none S. pyogenes Huang PX853 62885 Mammalian BbsI yes, cut, N-terminal S. pyogenes Zhang PX854 62886 Mammalian...

... Monomer pET mOrange LIC cloning vector (u-mOrange) - Bacterial Expression pCS2+8CmOrange - Zebrafish/...pCS2+8NmOrange - Zebrafish/Xenopus/C.elegans/Sea urchin mOrange-N1 - Mammalian Expression mOrange-C1 -...Expression mOrange-pBAD - Bacterial Expression mOrange2 549 565 35 6.5 4.5 hr Monomer mOrange2-N1 - Mammalian...Expression LSSmOrange 437 572 23 5.7 2.3 hr Monomer pLSSmOrange-C1 - Mammalian Expression pLSSmOrange-N1 - ...Structure Plasmids mKusabira-Orange (mKO) 548 559 31 5 4.5 hr Monomer pQC mKorange IX - Mammalian Expression...Expression mKusabira Orange-C1 (mKO) - Mammalian Expression mKO-pBAD - Bacterial Expression mOrange 548 562 49 ...Mammalian Expression mOrange2-C1 - Mammalian Expression mOrange2-pBAD - Bacterial Expression mKO2 551 565...

... CMV Alzheimer's Karsten Melcher 178115 ANG_Halo_C_allele ANG Halo ALS Michael Ward 178116 PRNP_Halo_C_allele...Dong-Er Zhang 12421 pMCSF-R(mA)-luc CSF1R CSF1R Hereditary diffuse leukoencephalopathy Dong-Er Zhang 12422...Dong-Er Zhang 12424 pMCSF-R(DD)-luc CSF1R CSF1R Hereditary diffuse leukoencephalopathy Dong-Er Zhang 12425...ATM H1 Ataxia telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia Didier Trono ...TARDBP GFP CMV ALS Zuoshang Xu 28196 tdp43-EGFP construct3 TARDBP GFP CMV ALS Zuoshang Xu 28197 tdp43-EGFP...TARDBP GFP CMV ALS Zuoshang Xu 28198 tdp43-EGFP construct5 TARDBP GFP CMV ALS Zuoshang Xu 28199 tdp43-EGFP...TARDBP GFP CMV ALS Zuoshang Xu 28200 tdp43-EGFP construct7 TARDBP GFP CMV ALS Zuoshang Xu 28201 tdp43-EGFP...

..., a conformational change in the sensing region of the construct leads to a change in signal of a circularly...GECI) that reports with lifetime and intensity changes A turquoise fluorescence lifetime-based biosensor... biosensors from nested reporters of green- and orange-emitting proteins Ratiometric Matryoshka biosensors...biosensors from a nested cassette of green- and orange-emitting fluorescent proteins. Nat Commun. 2017 Sep...activities in live cells. eLife. 2018 Jul 3;7. Jin Zhang Calcium ER or mitochondria-targeted CEPIA calcium...Islets. Anal Chem. 2019 Oct 1;91(19):12212-12219. Huiwang Ai Zinc GZnP2 Cytosolic fluorescent sensor for ...spatiotemporal dynamics of ATP in single cells. Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi...

...Bacterial TAG Huiwang Ai 153558 pMAH-EcaYRS EcaYRS E. coli 3-aminotyrosine Mammalian Huiwang Ai 154762 pAS_FLAG-Mma...TAG sites changes to UAG, RF1 function removed George Church 48999 C321 all TAG sites changes to UAG George...sites changes to UAG, RF1 function removed Farren Isaacs 87359 C321.∆A.opt all TAG sites changes to UAG...machinery. To expand the genetic code, 4 major changes to the standard translation machinery are needed...copies of the tRNA. Applications By making small changes in selected amino acids within a protein, any alterations...introduced amino acid can also be used to intentionally change the activity of a protein (e.g. converting a DNA...tyrosyl-tRNA synthetase E. coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG...

...BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. 2013. Dynamic imaging... Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. 2013. Multiplex genome engineering... as guanosine, so the overall effect is an A->G change. Since this method targets RNA rather than DNA,...cerevisiae and S. pombe ) Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P,...27096365 Ma H, Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling ...PMID: 25713381 Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T. 2016. Multiplexed labeling...Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Barrangou R, Brouns SJ, Charpentier E, Haft DH, Horvath ...

...MISR2, MISRII ANGPT1 angiopoietin 1 AGP1, AGPT, ANG1 ANGPT4 angiopoietin 4 AGP4, ANG-3, ANG4, MGC138181,...MGC138183 ANGPTL1 angiopoietin-like 1 ANG3, ANGPT3, ARP1, AngY, KIAA0351, UNQ162, dJ595C2.2 ANGPTL2 angiopoietin-like..., HARP, MGC8889 ANGPTL3 angiopoietin-like 3 ANGPT5 ANGPTL4 angiopoietin-like 4 ANGPTL2, ARP4, FIAF, HFARP...pp1158 ANGPTL5 angiopoietin-like 5 - ANGPTL6 angiopoietin-like 6 AGF, ARP5 ANGPTL7 angiopoietin-like 7... 1 guanine nucleotide exchange factor VAV VAV2 vav 2 guanine nucleotide exchange factor - VAV3 vav 3 guanine...TPAR1 CXCL13 chemokine (C-X-C motif) ligand 13 ANGIE, ANGIE2, BCA-1, BCA1, BLC, BLR1L, SCYB13 CXCL14 chemokine...

...pyogenes 24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...pyogenes 24336571 Zhang EGFP A. victoria GGCCACAAGTTCAGCGTGTC 51762 cut S. pyogenes 24336571 Zhang EGFP A. victoria...pyogenes 24336571 Zhang EGFP A. victoria GGTGAACCGCATCGAGCTGA 51765 cut S. pyogenes 24336571 Zhang EGFP A. victoria...pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330 Zhang lC.GA4a B. oleracea...pyogenes 26145478 Zhang PAX6 H. sapiens GTAGATTTTGTATGCACTGC 68465 cut S. pyogenes 26145478 Zhang PcfiA AAACAAAACCTCATCAGGCA...CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate...ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462 Jiang ade6-L469 S. pombe TCTATTGTTCAGATGCCTTG 52227 cut...

....0 37184 pCAG-T7-TALEN(Sangamo)-Destination Pawel Pelczar pCAG-T7-TALEN(Sangamo)-Destination constructs.... 40131 pCAG-T7-TALEN(Sangamo)-FokI-KKR-Destination 40132 pCAG-T7-TALEN(Sangamo)-FokI-ELD-Destination ...Validated in zebrafish somatic cells. Keith Joung Zhang Lab TALE Toolbox PCR/Golden Gate cloning method....method. Optimized for human expression. Feng Zhang LIC TAL Effector Assembly Kit Assembly by ligation-independent...TALEN backbone, which were initially published by Sangamo BioSciences (N153AA, C63AA) and showed robust cleavage...activity in several later studies. pCAG-T7-TALEN(Sangamo)-Destination vectors are available with homodimeric...mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids Thoru...

...Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation Mouse Zhang 3rd 3...flanking site (PFS) Library 79153 Knockout E. coli Zhang N/A N/A N/A - The protospacers contained in the ...4096 (4 6 ) combinations of 6 nucleotides. Chong Zhang E. coli Genome-wide Inhibition Library 113134 — ... 113138 113146, 113147 Inhibition E. coli Chong Zhang N/A 15 Varies CRiNCL - Human CRISPRi Non-coding ...Regulator Library 200011 Knockout Mouse Griffin, Manguso, and Bernstein 3rd 6 ~5616 Mouse CRISPR Knockout... plasmid) 1000000049 (2 plasmid) Knockout Human Zhang 3rd 6 123,411 Human genome-wide library v1 69763...Activation Pooled Library 1000000106 Activation Human Zhang 3rd 10 96,458 Human CRISPR Metabolic Gene Knockout...

...dynamic range, and resistance to photobleaching has made luciferase a common choice in assays ranging from...bioluminescence found in a diverse number of organisms, ranging from bacteria to aquatic animals to insects. Luciferase...transfection or viral infection efficiency, to study changes in cell physiology, or as a reference level of ...of expression. Scientists have developed a wide range of luciferase-based plasmid systems for many different...brighter signal and emission in the near-infrared range, enabling enhanced bioluminescence imaging in vivo...toolkit to assess the proteostasis status in a wide range of experimental systems. LumiLuc and LumiScarlet...

...fused to the N-terminus of LSSmOrange pLSSmOrange-C1 Orange Mammalian Express a gene of interest fused ... GFP variant) commonly used with mRuby2 pLSSmOrange-N1 Orange Mammalian Express a gene of interest fused...to measure protein interactions or conformation changes, as well as FRET standards. Plasmid...intermolecular or bimolecular FRET) or (2) conformational changes within a protein where the donor and acceptor are...fused to the C-terminus of LSSmOrange mRuby2 Red Mammalian Expresses mRuby2 (a RFP variant) commonly used ...

...of long-range inhibitory neurons. Preprint (Link opens in a new window) Yu K, Ahrens S, Zhang X, Schiff...ZR, Chen WZ, Liu MZ, Chen XJ, Wan L, Zhang XY, Yuan L, Lin JK, Wang M, Zhou L, Xu XH, Sun YG. 2019. Tac1...Haynes TM, Hochbaum DR, Huang KW, Hyun M, Umadevi Venkataraju K, Straub C, Wang W, Robertson K, Osten P... Perry C, Diester I, Boyce FM, Bass CE, Neve R, Huang ZJ, Deisseroth K. 2014. Targeting cells with single...AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang UJ, Rayport S. 2018. Dopamine neuron glutamate cotransmission...Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs. Cell Rep. 28(13):3450-3461. PubMed...

...University of California, Berkeley. CRISPR Software Sanger Indel Analysis ICE (Inference of CRISPR Edits) ... at a given locus. To use the tool, you'll need Sanger sequencing reads from PCR amplicons that cover ... budding and fission yeast. Target Finder (Feng Zhang lab) Identifies gRNA target sequences from an input...non-model invertebrate species. Forums and FAQs Feng Zhang lab: Tips for CRISPR design, homology directed repair...cloning . CRISPR Discussion Group (moderated by Feng Zhang lab): Forum/FAQ Drosophila: General Advice and Forum...pSL1180-HR-PUbECFP & pSL1180polyUBdsRED PDF 583.3 KB Zhang gRNA cloning CRISPR RNA array: Cas9 (pX260) or Cas9...Cas9 (pX330) or Cas9 D10A (pX335) ; PDF 248.6 KB Zhang sgRNA cloning lentiCRISPR v2 packaging plasmids:...

...material will be rearranged. The schematic below shows the three types of rearrangements: inversion, deletion...Cre-Lox system and how it can be used for genetic rearrangements and recombination. Use Addgene's curated tables...2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR...-hGHpA-ITR Cre and sgRNA coexpression Cbh AAV Zhang 60231 AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-...KASH-tagged EGFP, and sgRNA expression hSyn AAV Zhang 60820 pSECC Cre, Cas9 and sgRNA expression EF-1 ...Jacks 68468 Cas9-2A-Cre Cas9 and Cre CAG Mammalian Zhang 68477 pTRE:iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, ...86641 pLenti-hSynapsin-Cre-WPRE Cre hSyn Lentiviral Wang 86794 pCL20c-MSCV-IRES-CRE Cre MSCV Mammalian Roussel...

... producing antibodies, can change the constant region, and therefore change the isotype of antibodies ...variable regions, shown in light blue and light orange, that bind to a specific antigen, triggering an...constant region, and is shown in dark blue and dark orange. The constant region is a stable part of the antibody... There are several alternatives to antibodies, ranging from antibody fragments (shown in Figure 2) to ...expensive than HRP, fluorophores are available in a range of colors activated by different wavelengths, allowing... assay run. The standard curve should contain a range inclusive of all expected protein concentrates in...to distinguish cell types. Multiplex assays can range from two antibodies to upwards of twenty. Laser ...