Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 11 of 11 results

  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Michael J Fox Foundation MJFF 40424 LRRK2_1867_2161_L1914N_V2048T LRRK2 His, TEV, GST polH Parkinson's... J Fox Foundation MJFF 40425 LRRK2_1867_2161_L1914N_V2048T_F2083Y_I2131S LRRK2 His, TEV, GST polH Parkinson's...Fox Foundation MJFF 40426 LRRK2_1867_2161_L1914N_L1936Y_V2048T_F2083Y_I2131S LRRK2 His, TEV, GST polH ...Foundation MJFF 40427 pEMB017 NP_9409803_LRRK2_1867_2161_L1914N_V2048T_F2083Y LRRK2 His, TEV, GST polH Parkinson's...Foundation MJFF 40428 LRRK2_1867_2161_L1914A_L1976Y_C2024S_C2025S_I2049Q_F2083A LRRK2 His, TEV, GST polH... J Fox Foundation MJFF 40430 LRRK2_1867_2161_L1914A_C2024S_C2025S_I2049Q LRRK2 His, TEV, GST polH Parkinson's...Michael J Fox Foundation MJFF 40431 LRRK2_1867_2161_L1914A_L1976Y LRRK2 His, TEV, GST polH Parkinson's...

  2. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV.CAG.GCaMP6s.WPRE.SV40 GENIE, Douglas Kim AV-1-PV2914 98930-AAV1 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Loren...pAAV.CAG.GCaMP6s.WPRE.SV40 GENIE, Douglas Kim AV-5-PV2914 98930-AAV5 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Loren...pAAV.CAG.GCaMP6s.WPRE.SV40 GENIE, Douglas Kim AV-9-PV2914 98930-AAV9 pENN.AAV.GFAP.iGluSnFr.WPRE.SV40 Loren...

  3. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Actin Filaments Actin mGold Francois St-Pierre 49149 mCh-alpha-tubulin Microtubules alpha-tubulin mCherry...mCh-Rab5 Early endosomes Rab5 mCherry Gia Voeltz 49147 BFP-Rab5 Early endosomes Rab5 BFP Gia Voeltz 61802...

  4. Validated gRNA Sequences

    Type
    Collection
    ...victoria GGCGAGGGCGATGCCACCTA 61051 cut S. pyogenes 24179142 Del Bene EGFP A. victoria GGGCACGGGCAGCTTGCCGG...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...

  8. Qi Lab CRISPR Page

    Type
    Collection
    ...fused to 2x NLS, p65 activation domain and tagBFP 46914 pU6-sgGFP-NT1 Human pSico-based U6 vector containing...

  9. Cheng Lab CRISPR Casilio System

    Type
    Collection
    ...mCBPHAT_4xNLS_PUFa_2xNLS in pCR8 Gateway donor vector 71914 pAC1417-pmax-4xNLS_PUFa_2xNLS_mCBPHAT 4xNLS_PUFa...

  10. Chemogenetics Plasmids

    Type
    Collection
    ... pAAV EF1a HA-hM4D(Gi) hM4D (Gi) EF1a No Harvey 89149 pOTTC1328 - pAAV EF1a HA-hM3D(Gq) hM3D (Gq) EF1a...

  11. Immunology Research Plasmids and Resources

    Type
    Collection
    ...FLJ34282, FLJ39737, FLJ46484, M-sema-G, MGC169138, MGC169141, SEMAJ, coll-4 SEMA4F sema domain, immunoglobulin...factor 9 (glia-activating factor) GAF, HBFG-9, MGC119914, MGC119915 FGFR1 fibroblast growth factor receptor...
Showing: 1 - 11 of 11 results