... throughout the chromosome. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...faithfully introduce specific genomic changes. ID Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 51306 pUC57-Simple-gRNA backbone T7...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...at a much lower efficiency than NHEJ. ID Plasmid Gene/Insert Vector Type Promoter PI Publication Empty...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 46759 pT7-gRNA T7 BsmBI In vitro transcription...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...Adeno-associated virus (AAV) vectors are safe and useful gene delivery tools that effectively transduce many mammalian...Packaging Service overview. Function Chemogenetics DREADDs, PSAMs Optogenetics Channelrhodopsins, Halorhodopsins...Ready-to-use adeno-associated virus (AAV) available from Addgene's viral vectory packaging service. Browse constructs...preps are purified by density centrifugation. Addgene’s comprehensive high-quality quality control process...shipment. If you can't find the prep you need, try Addgene's AAV Packaged on Request service. You can choose...

...you to create fusion proteins with your gene of interest....protein (GFP) was cloned in 1992 ( Prasher et al., Gene, 1992 ), and since then scientists have engineered...tags for you to create fusion proteins with your gene of interest. These are organized By Color of the...Lab Lentiviral Plasmids - Fluorescently tag your gene for lentiviral expression Verkhusha Lab Plasmids...Addgene has assembled a collection of empty plasmid backbones with different fluorescent tags for you...Monomer? Background Fluorescent proteins are genetically encoded tools that are used extensively by life...proteins that result in a diverse set of colors. Addgene has assembled a collection of empty plasmid backbones...

... of Gateway-compatible pDEST vectors. ID Plasmid Gene/Insert Industry PI Pooled Libraries CRISPR and overexpression...engineering forms the core of the deorphanizing engine. Genetic and proteomic interactions represent the framework.... Protein production is used for assays and to generate antibody/ high-affinity ligands. Data is embedded...integrated knowledgebase that features, among others, genetic variants and disease associations. Plasmids This...overexpression pooled libraries are useful tools for genetic screening experiments. These libraries target the...

...site-specific recombinases, which can be used to control gene expression. Dre AAV ID Name Promoter Fluorophore...

...an empty backbone can be repeated to ligate your gene of interest after the promoter, and so on. The following...

...adenoviral plasmids. Want an adenoviral plasmid with your gene of interest? Search our database for adenoviral ...capacity (>8 kb), high titers, and high levels of transgene expression. Additionally, these viruses are able...Disadvantages of adenoviruses include transient transgene expression, as well as the substantial immune ...transfected into mammalian packaging cell lines to generate adenovirus particles. Read our Adenoviral Guide...terms Adenoviral Strains Bacterial strains for generating adenovirus. ID Strain Description PI 16398 BJ5183... Shuttle For production of viruses containing transgene under a chosen promoter Vogelstein 16403 pShuttle-CMV... Shuttle For production of viruses containing transgene under CMV promoter Vogelstein 16404 pAdTrack Shuttle...

...currently available to industry scientists. ID Plasmid Gene/Insert PI Kits Kit name Type PI Description High...Packaging from Addgene Parkinson's Research from The Michael J Fox Foundation Search Use Addgene's Search to...protection for material providers. Addgene’s deposit agreements allow Addgene to distribute plasmids on behalf...can be submitted to Addgene through your user account or by email to mta@addgene.org . After we review ...A portion of Addgene’s collection is available to qualified for-profit entities. Addgene reserves the ...Addgene has a growing collection of plasmids that are available to industry. Learn more about the available...assembling standardized parts to create eukaryotic multigene constructs. Pooled Libraries Pooled Library name...

...-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions ...Find information on Addgene's collection of plasmid-based antibodies, including monoclonal antibodies...Plasmid Collection Antibody Plasmid Collection Addgene distributes ready-to-use recombinant antibodies...application-specific validation and quality control by Addgene as well as by our trusted partner labs. Learn More...animals or hybridoma cells, but are difficult to generate due to expense and time. An alternative approach...fragment libraries from chickens Methods for the generation of chicken monoclonal antibody fragments by phage... 2015 Oct;167(2):95-102. Joanna Bereta Sybody Generation Toolbox for making synthetic nanobodies (sybodies...

...opsins , genetically-encoded calcium indicators, and rabies targeting genes. Recombinases Addgene ID Plasmid...definitions (e.g. neurons defined by a single gene or projection). Intersectional expression approaches ... in well-defined cellular sub-populations has generally been limited to single-component cellular definitions...cells based on a doubly-specified combination of genetic and/or anatomical-defined parameters, by placing...Operating Procedure (Link opens in a new window) with general principles for working with INTRSECT recombinases...pAAV-CaMKIIa-Flpo None Single recombinase-dependent Addgene ID Plasmid Logic Sites and Mutations 55641 pAAV-Ef1a-fDIO... Vcre Dual recombinase-dependent: Fluorophores Addgene ID Plasmid Logic Sites and Mutations 55650 pAAV-hSyn...

... disorders by enabling region- and cell-specific gene-delivery in the mouse brain through these human ...List of Pleiades MiniPromoters MiniPromoter Source Gene Construct Reporter Negative Control N/A pEMS1312...

...fluorescent biosensors to measure biomolecules or genes via FRET or other assays....specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...mitochondrial oxidative stress A novel MitoTimer reporter gene for mitochondrial content, structure, stress and...for a sensor for a different analyte, a sensor for gene-specific activity, or for popular biosensors in ... Cells", "mitochondria"). ID Plasmid Description Gene/Insert Vector Type PI Publication Return to Top ...also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics Plasmids ...palette of genetically encoded Calcium indicators (GECOs) An Expanded Palette of Genetically Encoded Ca2...

...useful for the incorporation phosphoserine into your gene of interest....by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., Science 2011). Follow... in Mohler et al., Mol Syst Biol 2023 and find general tips on phosphoprotein expression in rEcoli XpS... Biotech. 2018). This phosphosite library was generated in a single mixed pool by expressing and purifying...phosphosite library ( 111704 ) is available from Addgene. This library is anticipated to be useful for laboratories...assessments. The mode #1 phosphosite library can be generated with either phosphoserine using SepOTSλ ( 68292...domain of NEDD4-2; 111705-8 ) is available from Addgene. Screening kinases. The mode #1 phosphosite library...

...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...BsaI none S. pyogenes Chloramphenicol Marraffini pCas9 42876 Bacteria BsaI yes, cut S. pyogenes Chloramphenicol...none S. pyogenes Qi pDD162 (Peft-3::Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein...elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes Virmilion Bullock..., cut S. pyogenes Puro Liu pCFD4-U6:1_U6:3tandemgRNAs 49411 Drosophila BbsI none S. pyogenes Virmilion...Mammalian AfIII none S. pyogenes Bleocin Church MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108...

...Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into plasmids. Plasmids... tubulin (sometimes referred to as housekeeping genes). This allows for relative comparison of expression...Science Guides Antibody Guide Antibody Guide View Addgene's Antibody Collection Jump To: Antibody Guide Production...with myeloma cells (immortalized B cells). The genetic reorganization that creates variety in the antibody... be produced from plasmids, with an antibody’s genetic code inserted into the plasmid. This produces the...antibody is the antigen binding site. In B cells, the genetic region responsible for the variable region goes...epitopes on one antigen. Monoclonal antibodies are generated from cultured B cells, where each culture should...

...Abbreviations: AAV, adeno-associated virus; GRE, gene regulatory element; NHP, non-human primate. Image...Ready-to-use AAV available from Addgene's viral service. Engineered systemic constructs from Viviana ...As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use viral preparations...depth descriptions of each serotype, check out Addgene's blog on Systemic Capsids . To review performance...data of each of these serotypes, please refer to Addgene’s Data Hub and the Caltech CLOVER Center’s repository...produced with the pUCmini-iCAP-PHP.eB plasmid (Addgene #103005) . Note on PHP.eB tropism and specific ... BiSSTe4 dTomato/nlsdTomato Control Fishell Chemogenetics 44361 pAAV-hSyn-DIO-hM3D(Gq)-mCherry Syn Activator...

...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 41818 cut S. pyogenes 23287722... cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 70661 cut S. pyogenes 26472758...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...cut S. pyogenes 25352017 Zaratiegui ade6-M210 S. pombe TCTATTGTTCAGATGCTTCG 52226 cut S. pyogenes 25352017... 52225 cut S. pyogenes 25352017 Zaratiegui Alk and Eml M. musculus 64071 cut S. pyogenes 25337876 Ventura...

...associated with Addgene materials. Plasmids ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use...these antibodies are available at Addgene. AAV Viral Service . Addgene provides a viral service to help...the revolutionary dynamic picture of the brain generated through this effort will provide novel ways to...enables single cell, single millisecond resolution optogenetics. Human Synapsin (hSynapsin) promoter Edward ...enables single cell, single millisecond resolution optogenetics. Cre-dependent virus Edward Boyden 108422-AAV5...Hillel Adesnik 111066-AAV1 pAAV-hSyn-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...promoter Lin Tian 111067-AAV1 pAAV-CAG-dLight1.1 To generate Adeno-Associated viruses for expression of dLight1.1...