Skip to main content
Addgene
Showing: 61 - 80 of 86 results

  1. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Xenopus CRISPR Resources CRISPR Guide Viral Preps Protocols gRNA Design Tools CRISPR Blog Posts CRISPR requires... CRISPR Empty gRNA Vectors CRISPR Plasmids: Empty gRNA Expression Vectors Browse CRISPR Plasmids...plasmids and therefore are not limited to a single CRISPR function. Alternatively, gRNA-only plasmids can...gRNA sequence, such as BsbI or BsaI Cas9 (or other CRISPR) system that the vector was designed to be used...to be used with. crRNAs used with Cpf1 or other CRISPR systems are also listed here and denoted as such...enzymes? CasPEDIA is an encyclopedia of Class 2 CRISPR systems with wiki entries describing enzyme activity...Plasmids Expression System Description PI Multiplex CRISPR/Cas9 Assembly System Kit Mammalian A system for...

  2. Depositor Collections

    Type
    Collection
    ...Trimmer Lab Recombinant mAb Plasmid Collection CRISPR CRISPR-on: an RNA-guided transcriptional activator ...Browse depositor collections of antibody, CRISPR, disease research, visualization, protein expression...

  3. Rett Syndrome

    Type
    Collection
    ...Addgene's CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources...'s Plasmids for Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach...examples of additional CRISPR resources can be found below: Base Editing RNA Editing CRISPR-based DNA methylation...Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources The (Link opens in a new...

  4. COVID-19 Resources

    Type
    Collection
    ...Lab Cas12a plasmids Addgene's full CRISPR guide and summary of CRISPR pooled libraries . FlipGFP-based ...coronavirus - Enabling coronavirus detection using CRISPR-Cas13: Open-access SHERLOCK research protocols ...develop the method termed DNA Endonuclease Targeted CRISPR Trans Reporter (DETECTR). Mammoth Biosciences has... of the 2019 novel coronavirus SARS-CoV-2 using CRISPR diagnostics: SARS-CoV-2 DETECTR (Link opens in ...now available from Ray Owens' lab. Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and...Abbott, et al. Cell. 2020 May 14;181(4):865-876.e12. CRISPR tools and reporters now available from Stanley ...

  6. Neurodegeneration Research Collection

    Type
    Collection
    ...Dhekne et al. Elife. 2023 Oct 24. See More CRISPR Tools Find CRISPR pooled libraries available from Addgene...neurodegeneration research. Disease Info Plasmid Collection CRISPR Tools AAV Viral Preps iPSC Differentiation Factors...about the blood brain barrier integrity, and using CRISPR screens to understand more globally how neurons.... Target neural oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent...plasmid pooled libraries . New and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al....

  7. Bacterial Expression Systems

    Type
    Collection
    ...list of our bacterial CRISPR plasmids, see here . pwtCas9-bacteria 44250 CRISPR Stanley Qi Anhydrotetracycline... list of our bacterial CRISPR plasmids, see here . pgRNA-bacteria 44251 CRISPR Stanley Qi Expression of...alter bacterial genomes. From recombineering to CRISPR , this collection contains a variety of tools to...research. Plasmid ID Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9... For a more comprehensive list of our bacterial CRISPR plasmids, see here . pGRG Series Various Plasmids...

  8. Validated gRNA Sequences

    Type
    Collection
    ...Sequences You may also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below...PAM sequence). Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments... Genome Engineering CRISPR Validated gRNA Sequence Datatable Validated gRNA...that have been experimentally validated for use in CRISPR experiments. This datatable is compiled from plasmids...experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets...possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate...Church GLuc synthetic GATCTAGATACGACTCACTAT 68422 CRISPR-display S. pyogenes 26030444 Rinn gp78 H. sapiens...

  9. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ... Plasmid Collection You May Also Like... CRISPR Guide CRISPR Protein Tagging Fluorescent Protein Guide...Roberts B, et al. 2017. Systematic gene tagging using CRISPR/Cas9 in human stem cells to illuminate cell organization...

  10. Antibody Plasmid Collection

    Type
    Collection
    ...BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system to rapidly engineer the constant immunoglobulin...diversification of hybridoma-produced antibodies by CRISPR/HDR genomic engineering. Sci Adv. 2019 Aug 28;5...

  11. Plasmids for Stem Cell Research

    Type
    Collection
    ...Retinal Ganglion Cells AAV/CRISPR Mouse Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms ...mitosis. Nat Commun. 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human...enogenous genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski... Brennand iPSCs Cortical or Lower Motor Neurons CRISPR/TALEN Human Transcription Factor-Mediated Differentiation...

  15. TALEN Expression Vectors

    Type
    Collection
    ...Keith Joung Lab plasmids Daniel Voytas Lab plasmids CRISPR plasmids This page lists plasmid vectors into which...

  17. Lentivirus Plasmids

    Type
    Collection
    ...lentiviral plasmids to express your CRISPR gRNA? Please see our CRISPR Empty gRNA plasmids table and search...

  18. TALEN Engineering

    Type
    Collection
    ...Keith Joung Lab plasmids Dan Voytas Lab plasmids CRISPR plasmids The Joung Lab has developed three platforms...

  19. Luciferase Plasmids

    Type
    Collection
    ...pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV9-CRISPR knockout plasmid. Renilla luciferase is used to...Paul Khavari 109395 EFS-Vector Firefly EF1α AAV-CRISPR knockout plasmid. Firefly luciferase is used to...transfection Sidi Chen 109396 TBG-Vector Firefly TBG AAV-CRISPR knockout plasmid. Firefly luciferase is used to...

  20. Distribution to Industry

    Type
    Collection
    ...Featured Collections COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the Michael Davidson...
Showing: 61 - 80 of 86 results