...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...

... reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array coding...collection comprises 20 plasmids, each carrying two CRISPR guides. The first one binds to sfgfp with either 0, ...From the Bikard Lab, CRISPR plasmid collection for modulating expression levels of two targets independently...Repression Collection Bikard Lab CRISPR Repression Plasmids You may also like... CRISPR Guide CRISPR Protocols...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range...18, or 20 matching nucleotides. Together, these plasmids allow to explore the whole range of expression...amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick integration of the aTc-inducible...

...tracrRNA: This plasmid contains three expression cassettes. To target a given site, the plasmid can be digested...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: These plasmids contain two expression...guide acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor...acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and...adenocarcinoma pathology. These plasmids as well as a backbone plasmid for cloning new targets are described...present within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA...

...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs...provide important details including the protein and plasmid sequence, the antigen sequence, and cross-species...develop and refine these application lists. The plasmids we use to produce antibodies are available as ...as part of Addgene’s larger Antibody Plasmid Collection , which also includes other types of affinity reagents...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins...? Check out our current collection of Antibody Plasmids , fill out our Suggest an Antibody form, or email...

... Biosensors Luciferase Plasmids Subcellular Localization Optogenetics Plasmids Viral Service: AAV Biosensors...troponin C Griesbeck Lab Twitch Plasmids Oliver Griesbeck Calcium erGAP3 (GFP-Aequorin Protein) for imaging...FLAMP1 and FLAMP2 Chu Lab FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an Internal Control. Mol Cell. 2016...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Collection of plasmids encoding fluorescent biosensors to measure biomolecules or genes via FRET or other...

... Plasmid Collections Worm Plasmids Worm Plasmids and Resources Plasmid Tools Worm Constructs...some of the plasmids and tools available at Addgene for use in worms. Browse Plasmids Plasmid Tools for ...complete list of plasmids that can be used in worms, search Addgene's entire collection. ID Plasmid Description... Gene/Insert PI Plasmids Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm...sequence: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great plasmid tools for the... tools , or by suggesting plasmids for the collection. Return to top Plasmid Kits and Collections Kits...system for controlled gene expression in Caenorhabditis elegans. - Jane Hubbard Lab. Plasmids for the temporal...

...pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...proteins, including calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors... 140555 pAAV-hsyn-GRAB_DA-mut Syn GRAB_DA-mut (control) none Constitutive 9 Li 140556 pAAV-hsyn-GRAB_rDA1m...140558 pAAV-hsyn-GRAB_rDA-mut Syn GRAB_rDA-mut (control) none Constitutive 9 Li 208698 pAAV-hSyn-GRAB-gDA3m...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...pGP-AAV-syn-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218877 pGP-AAV-syn-flex-iGABASnFR2...

...lentiCRISPR v2 packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF 2.3 MB Zhang GeCKO pooled...lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Kits are also available (...vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (...collaboration with the labs who have deposited CRISPR plasmids , we've created a series of links and guides to...on Addgene's blog Protocols Lab(s) Description Plasmids in protocol Download protocol Church gRNA design...gRNA design and cloning for Cas9 orthologs Cas9 plasmids PDF 104.1 KB Chen and Wente Zebrafish: gRNA cloning...(Cre recombinase) PDF 102.5 KB Jaenisch CRISPR plasmid summary for transcriptional activation dCas9 activators...

.../Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII...We provide high quality AAV preps from select plasmids in the repository. Browse our AAV collection of...site-specific recombinases, which can be used to control gene expression. Dre AAV ID Name Promoter Fluorophore...retrograde serotype, produced with the AAV retro helper plasmid from the Karpova and Schaffer labs. See the Retrograde...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson...

...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene's collection of plasmids suitable for FRET experiments to measure protein interactions or conformation... Plasmid Collections Fluorescent Proteins FRET Fluorescent...these types of studies Addgene has a collection of plasmids suitable for creating individual fluorescently...Encoding Fluorescent Proteins for FRET The following plasmids can be used to create a fluorescent fusion protein...of interest and the listed fluorescent protein. Plasmid Color Expression Description pPROEX Aqua Cyan Bacterial...SYFP2 Clover Green Mammalian Expresses Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-N1...

...was developed by Shannon Boye’s lab. Plasmid Information The plasmid below is available in each of the above...pTR-UF11 chimeric CMV/Chicken Beta actin (CBA) GFP Control Sergei Zolotukhin Citation Information AAV2(Y444F...We provide high quality AAV preps from select plasmids in the repository. Browse the University of Florida...production , these viral vectors undergo quality control, including AAV titration by ddPCR, in vitro and... preparations were produced with the pTR-UF11 plasmid ( Addgene #157970 ). Viral preparations are formulated...above serotypes and buffers. Please click on the plasmid name for ordering information. ID Name Promoter...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need....

... Viral Plasmids Lentiviral Plasmids Lentiviral Plasmids Additional Resources... Pooled Libraries All Viral Plasmids Packaging Plasmids Transfer Plasmids Lentiviruses, a subset of retroviruses...among multiple plasmids. Some plasmids (typically called packaging and envelope plasmids) encode components...expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. Cheng 17452 pLenti CMV Puro DEST 3rd... empty plasmid with EGFP marker. See plasmid 14749 for Thy1.1 selection. Benoist and Mathis 21915 Tet-...conjunction with the plasmid that encodes the viral genome (typically called the transfer plasmid ). This table...packaging plasmids that can be used with 2nd and 3rd generation lentivirus technologies. ID Plasmid Generation...

...Collections Antibody Plasmid Collection Antibody Plasmid Collection Addgene distributes ready-to-use recombinant... table highlights plasmid collections that can be used to create and express plasmid-based antibodies....Apr 8. Markus Seeger Antibody Plasmids The table below highlights plasmids that feature expression of antibodies...sort buttons to find antibody plasmids for: Common antigens such as GFP or mCherry Monoclonals, Nanobodies...) ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions for other plasmids that ...collection of plasmid-based antibodies, including monoclonal antibodies, scFvs, and nanobodies. Plasmid... Plasmid Collections...

...Always express first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You...Generally, you will need two plasmids, as depicted in the figure below: A plasmid expressing the tRNA and ... included. Browse Synthetase Plasmids The table below highlights plasmids that contain aminoacyl tRNA ...Many of the plasmids also contain one or more copies of the cognate tRNA gene. ID Plasmid Synthetase Origin...Abhishek Chatterjee Browse Target Plasmids The table below highlights plasmids that contain genes with modified...Addgene's guide to plasmids and strains useful for expanding the genetic code in bacteria and mammalian... Plasmid Collections Genetic Code Expansion Genetic Code Expansion You may also like... GCE4All...

... and plasmid collections that may help with your neurodegeneration research. Disease Info Plasmid Collection...Research Tools Neurodegeneration Plasmid Collection A collection of plasmids expressing wild type or mutant...Subcellular Localization, Optogenetics Plasmids, and Chemogenetics Plasmids. New and Noteworthy: Explore NeuroPAL...more. Plasmids provided by the foundation can be found on our Michael J. Fox Foundation Plasmid Resource...Find out about the plasmid collections available at Addgene that may be useful for neurodegeneration ...neurons in the substantia nigra, one of the movement control centers in the brain. The cause of this neuron ...genes linked to neurodegenerative disorders. Find plasmids expressing HTT, C9ORF72, LRRK2, Synuclein, and...

...NeuroMab/Trimmer Lab Plasmid Collection R-mAb Plasmids scFv Plasmids Nanobody Plasmids Protocols References...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86... Antibody Plasmid Collection NeuroMab Plasmid Collection... the plasmid, followed by the SV40 polyA tail (SV40 pA). Recombinant Monoclonal Antibody Plasmid Collection...following plasmids can be used to produce R-mAbs from transfected mammalian cells. Addgene ID Plasmid Target...

... Plasmid Collections Zebrafish Plasmids Zebrafish Plasmids and Resources... of the plasmids and tools available at Addgene for use in zebrafish. Browse Plasmids Plasmid Tools for...for plasmids containing your zebrafish gene of interest? Search Addgene's collection for plasmids that...highlights plasmids that contain tools for use in zebrafish research. This includes plasmids for genome...and Cre expression plasmids. Large collections or kits are described below . ID Plasmid Description Gene...optogenetically controlled Cre/loxP system that enables precise temporal and spatial control of gene expression...expressed. EXPRESs Plasmids for Zebrafish Receptors and Zebrafish Monoclonal Antibody plasmids - Gavin Wright...

...Accessory Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular...Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that can be used for...particles See Addgene's Viral Plasmids and Resources page for more information. Plasmids Expressing Spike and ...Addgene plasmid #141347) is available in standard format and as a Lentiviral prep . ID Plasmid Description...COVID-19 and Coronavirus Plasmids & Resources Ginkgo Bioworks COVID-19 Plasmid Collection Return to top...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Addgene's collection of plasmids for viral pseudotyping with SARS-CoV-2 spike protein. Collections...

...nucleocapsid protein (Brian Geiss). Plasmids SARS-CoV-2 Plasmids Many plasmids containing SARS-CoV-2 sequences...MERS, BAT-CoV Plasmids ID Plasmid Description Industry PI Due to export control regulations, MERS and SARS-CoV...Addgene will maintain this plasmid collection page, which highlights plasmids available that may be useful...SARS-CoV-2 nucleocapsid protein. SARS-CoV-2 Plasmids : Plasmids that are available or coming soon containing...containing SARS-CoV-2 sequences. SARS-CoV Plasmids : Plasmids that are available containing SARS-CoV (SARS ...to popular envelope and packaging plasmids. Ginkgo Bioworks Plasmid Collection - Addgene has partnered...Bioworks to distribute SARS-CoV-2 plasmids. The collection contains: Plasmids for E. coli and Yeast expression...

... Plasmid Collections Pleiades Promoter Plasmids Pleiades Promoter Project The...using the links to view individual plasmid webpages. These plasmids are described in Portales-Casamar ...Negative Control N/A pEMS1312 cre N/A pEMS1301 cre/EGFP/NLS N/A pEMS1308 EGFP/cre N/A pEMS1302 EGFP/cre/NLS...N/A pEMS1306 EGFP/NLS N/A pEMS1307 EGFP/NLS N/A pEMS1313 intron-lacZ/NLS Positive Control CAG promoter...Plasmids from the Pleiades Promoter Project - A regulatory toolbox of MiniPromoters to drive selective...human MiniPromoters. Browse the Pleiades Promoter Plasmids using the table below. Additional information ...pEMS1153 EGFP/NLS Ple37 CRH pEMS1154 EGFP/NLS Ple38 CRH pEMS1155 EGFP/NLS Ple39 CRH pEMS1156 EGFP/NLS Ple44...