...make targeted epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic ... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...enhancer for your gene of interest. Available modifications include: histone acetylation by p300 histone...or MQ1 cytosine demethylation by Tet1 These modifications persist over time and are potentially heritable...tables below for CRISPR plasmids for epigenetic modification in mammalian or plant systems. Mammalian Plasmid...

...superior for less favorable protospacers and applications requiring particularly tight binding. In these...advisable to use the consensus sequence. See the publication for details. A protocol for synthesizing gRNAs...expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48650 PM-SP!TB Bacterial...expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol 48651 PM-NM!TA Bacterial...expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48652 PM-NM!TB Bacterial...expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol 48653 PM-ST1!TA Bacterial...expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48654 PM-ST1!TB Bacterial...

...Description Category PI Citation Information When using the Caltech serotypes in future publications, please...Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato...Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-...Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10...Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B22...

...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid...Promoter PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans ...Promoter PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9 fused to a transcriptional activator...

...of a catalytically inactive form of Cas9 (dCas9) plus guide RNA (gRNA) for biochemical purification (Fig...protein such as LexA are subjected to affinity purification (Fig. 1). In enChIP, specific genomic regions...537-548. doi: 10.1093/dnares/dsx023. PubMed . Identification of physical interactions between genomic regions...10.1111/gtc.12341. Epub 2016 Feb 5. PubMed . Identification of non-coding RNAs associated with telomeres...26. doi: 10.1186/s12867-014-0026-0. PubMed . Identification of proteins associated with an IFNgamma-responsive...Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding.... doi: 10.1016/j.bbrc.2013.08.013. PubMed . Identification of telomere-associated molecules by engineered...

...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...all the antibodies currently available from our catalog. Addgene values transparency and accessibility ...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...intractable via animal immunization. Addgene's antibody catalog is a community resource that is growing! We welcome...

...the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 37825-AAV1....the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 50465-AAV1....sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample is denoted...denoted with a .T suffix (for example, AAV1.T). The catalog ID for the 100 µL sized sample does not have the...from the CAG promoter. For information about each catalog item, including the titer and quality control, ... synpasin promoter. For information about each catalog item, including the titer and quality control, ...

...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant Plasmid... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...editors are created by fusing Cas9 nickase or catalytically inactive “dead” Cas9 (dCas9) to a cytidine deaminase...and are thus well suited to directed evolution applications. Examples of these base editing systems include...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

.... Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...

... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ...Gradinaru 105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...108912-AAV9 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 Cation channelrhodopsin ChroME targeted to the neuronal.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2...and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector expressed...2P-WPRE Double floxed genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector under ...

...: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic subunit gamma... below. Color is used for clarity and does not indicate a specific relationship. The content and map for...Research Color is used for clarity and does not indicate a specific relationship. The content and map for...Phosphatidylethanolamine binding protein 1 PIK3 Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl...PLXNB1 Plexin B1 PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5...

... the original publication below. You can also download the full-text of the publication here . Article...given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function... of Visualized Experiments (JoVE). The video publication by Stuart Orkin's and Daniel Bauer's labs details...addition, we describe techniques for deletion, identification, and characterization. This strategy relies...elements. For creating a gene knockout, two sgRNA located within exons will enrich even monoallelic deletion...Alternatively use another transfection method such as cationic liposome-based transfection. Optimize transfection...10.3791/52118 (2015). PubMed For the complete publication, including representative results and discussion...

...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation kinetics and localization...A multicolor atlas for whole-brain neuronal identification in C. elegans. Yemini et al. Cell. 2021 Jan...Alzforum is a news website and information resource dedicated to helping researchers accelerate discovery and...Banks Rodent Models Michael J Fox Foundation is dedicated to finding a cure for Parkinson's disease through...

...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Plant Plasmid Gene... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9, or dCas9 fused to a transcriptional...

...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Drosophila... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Description Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

...Blood Cells. Stem Cells. 2012 Nov 29. Yamanaka Replicating EBNA1 episome Human Non-integrating EBNA1-mediated... Nat Methods. 2011 May;8(5):409-12. Yamanaka Replicating EBNA1 episome Human Non-integrating polycistronic... S A. 2014 Jul 22;111(29):10678-83. Capecchi Replicating EBNA1 episome Human Fluorescent-tagged EBNA1-...Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1-mediated...RNA Human Non-integrating, polycistronic, self-replicating VEE RNA species expressing human Oct4, Klf4, ...generation of human iPSCs by a synthetic self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54....Science. 2008 Nov 7;322(5903):949-53. Yamanaka Replicating EBNA1 episome Mouse Non-integrating EBNA1-mediated...

.... Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...

...dehydrogenase (MDH). The MCC is a national group of educational leaders providing research opportunities to their...other members of the MCC community. They support educators interested in integrating MDH-related research...professional development, membership to a local hub of educators teaching MDH CUREs, and opportunities to mentor...of action, regulation and post-translational modifications, and metabolic pathways and protein interactions...His-tags are cloned at the C-terminus of MDH and, if indicated on the plasmid map, a TEV cleavage site is present...access for biochemistry research in undergraduate education: The malate dehydrogenase CURE community. J Biol...

...antibodies are produced in-house and undergo application-specific validation and quality control by Addgene... Recombinant Antibody Reactivity Recommended Applications PI Don’t See What You’re Looking For? Please...within 1 business day regarding your account verification. Once your account has been verified, you will.... Pricing Addgene is a nonprofit organization dedicated to providing the scientific community with open...access to plasmid research tools. Pricing will be indicated on the product pages after you login to your account... the depositing institutions. These agreements indicate the language which we are allowed to use for distribution...

... maintained). Translocation: If the sites are on separate DNA molecules, a translocation event is generated...recognizes 34 bp loxP sites, and the orientation and location of the loxP sites determines how the genetic material... of rearrangements: inversion, deletion and translocation. Inversion: If the loxP sites are on the same...present. By expressing Cre at specific times or locations, you can precisely control expression of your ...constructs also contain fluorescent labels that indicate if recombination has occurred, allowing for direct...(pos36)GFP-9xGGS-Cre-6xHis Cre fused to highly cationic GFP variant T7 Bacterial Liu 62939 pET-Cre-6xHis...Mammalian Sato 122961 pcDNA3.1_PA-Cre-Y324F Catalytically inactive PA-Cre CMV Mammalian Sato 123128 pET-His-Cre...