...zebrafish gene of interest? Search Addgene's collection for plasmids that contain a zebrafish gene or sequence...Lab CRISPR/Cas9-based conditional mutagenesis in zebrafish - Wenbiao Chen Lab A CRISPR/Cas9 Vector System... zinc finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart research...zebrafish-specific gene expression database that provides information about when genes are active in developing...developing embryos. zfRegeneration - A database for gene expression profiling during regeneration. Seurat - R ...-type specific conditional gene inactivation - Jeffrey Essner Lab GeneWeld Vectors for Targeted Integration...modified CRISPR-Cas9 system - Shuo Lin Lab Re-purposed Ac/Ds transgenic system enabling CRISPR/dCas9-interference...

...Delivery Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 46759 pT7-gRNA ...none, need Cas9 plasmid Chen and Wente 42250 DR274 T7 BsaI In vitro transcription none, need Cas9 plasmid...at a much lower efficiency than NHEJ. ID Plasmid Gene/Insert Vector Type Promoter PI Publication Empty...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

... In Resistance Co-expressed Cas9 Depositing lab Cas9 species = S. pyogenes (PAM = NGG) 49014 pRPR1_gRNA...dead dCas9, or dCas9 fused to a transcriptional repressor peptide like KRAB, can knock down gene expression...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused ...Description Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to...transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or ... plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter Selectable... plasmid to target the dCas9-repressor to your specific locus. ID Plasmid Gene/Insert Promoter Selectable...

...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...pX330S-2-PITCh - expresses Cas9 & PITCh-gRNA pX330A-FBL/PITCh - expresses Cas9, PITCh-gRNA, & FBL-specific...Doyon lab, eSpCas9(1.1)_No_FLAG_AAVS1_T2 (Addgene #79888) , which expresses an untagged Cas9 AND a gRNA...Drosophila cells that uses PCR to generate both an expression cassette for the Cas9-programming sgRNA and HR donors...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ...

...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Drosophila ID Plasmid Gene/Insert Promoter PI ...catalytically inactive Cas9 (dCas9) is fused to FokI nuclease. When FokI dimerizes, it generates a double-strand...PI Publication Yeast ID Plasmid Gene/Insert Promoter PI Publication Do you have suggestions for other plasmids... CRISPR dCas9-FokI CRISPR: dCas9-FokI...with dCas9 fused to FokI for creating double-strand breaks (DSBs). CRISPR...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...

...Plasmid Gene/Insert Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be...(HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 H840A nickase fused... to immunoprecipitate FLAG-tagged Cas9. In the CAPTURE system, Cas9 is tagged with a biotin acceptor site...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Visualize A catalytically inactive Cas9 (dCas9...dead dCas9, or dCas9 fused to a transcriptional repressor peptide like KRAB, can knock down gene expression...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to...transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or ...

...lab utilizes a CRISPR/Cas9 based approach to knockout, repress, and activate gene targets. To accomplish...fusion for gene activation CRISPR/Cas9 Plasmid Variants Figure 1: Schematic of the CRISPR Collection. Plasmids... plasmids dCas9-KRAB-MeCP2 fusion for gene and non-coding enhancer sequence repression dCas9-VPR fusion...CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing mouse...taken advantage of the Zhang lab all-in-one (guide/Cas9/reporter) pX458 plasmid family. They have made several...pX458 plasmid to expand its usefulness for the lab's gene regulation and developmental studies. Key plasmid...fate specification, yet differs from deleting both genes . Development. doi: 10.1242/dev.190272. PMID: 32541005...

...-expressed Cas9 Cas9 System Selection PI 46968 pICSL01009::AtU6p aU6 BsaI none S. pyogenes Kamoun 52255...HDR). ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused...dead dCas9, or dCas9 fused to a transcriptional repressor peptide like KRAB, can knock down gene expression...ID Plasmid Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to...transcription of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or ... plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert Promoter Selectable...

...the neomycin resistance gene 64325 3xFLAG-dCas9/p-bacteria Expresses 3xFLAG-dCas9 in E. coli in a tetracycline-dependent...consisting of a catalytically inactive form of Cas9 (dCas9) plus guide RNA (gRNA) for biochemical purification...CRISPR Cas9 gRNA plasmids from Dr. Hodaka Fujii's lab. Genome... expression vector with the puromycin resistance gene 63591 3xFN-Tel-TAL/pMXs-neo Expresses a 3xFLAG-tagged...(gRNA) to target human IRF-1 promoter for the Sa-Cas9 system. 105283 hIRF-1 gRNA #351 (Sa) Expresses a...(gRNA) to target human IRF-1 promoter for the Sa-Cas9 system. References An enChIP system for the analysis...Tanigawa N, Yuno M, Ikawa M, Taniuchi I, Fujii H. Genes Cells. 2018 Apr;23(4):318-325. doi: 10.1111/gtc.12573...

...Mammalian ID Plasmid Gene/Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication... genomic deletions. Compared to deletions generated by Cas9, large deletions created using Cas3 have fewer...underutilized compared to their Class 2 counterparts like Cas9. This is attributed in part to the difficulties ... Publication Plant ID Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...off-target effect. Which species or variant of Cas9 ( S. pyogenes , S. aureus etc.) was this gRNA sequence ...species or PAM binding variant of Cas9. For instance, wild-type SpCas9 must be used with targets that are... lists gRNA plasmids designed to target various genes or genomic regions. It is highly recommended that...the experimental use of these plasmids. ID Plasmid Gene/Insert Vector Type PI Publication Do you have suggestions...gRNA expression vectors available from Addgene. CRISPR...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...

...Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor... your target. Which species or variant of Cas9 ( S. pyogenes, S. aureus etc.) was this gRNA sequence designed...single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream...described on Addgene's CRISPR Plasmids and Resources page have been used to indicate the Cas9 application...cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut S. pyogenes 26044730...59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661...cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple, see article 69537 activate S. pyogenes 26352799...

...shRNA expression. Gene Switch: These constructs contain two genes of interest, Genes A and B. When Cre...Cre-dependent Cas9: Cre-dependent Cas9 can be knocked in to a mouse at the Rosa26 locus to facilitate Cas9 mediated...iRFP670, Cre, and GFP EFS Lentiviral Jacks 68468 Cas9-2A-Cre Cas9 and Cre CAG Mammalian Zhang 68477 pTRE:iRFP670...Cre-regulated gene expression. Depending on the construct, Cre may activate or repress gene expression. ... or “LSL” cassette) upstream of a gene of interest will prevent gene expression in the absence of Cre....the stop codon is excised, and gene expression proceeds. Cre-dependent Gene Knockout: Conversely, putting...on either side of a gene (called “floxing”, for “flanked by loxP”), will permit gene expression until Cre...

... ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter... for enChIP, as well as an anti-Cas9 antibody. Biotin tagging of dCas9 can be achieved by fusing a biotin...Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...inactive dCas9 is used to purify genomic DNA bound by the gRNA. An epitope tag(s) can be fused to dCas9 or ...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...biotin acceptor site to dCas9 and co-expressing BirA biotin ligase, as seen in the CAPTURE system. The ...

...ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacterial ID Plasmid Gene/Insert PI Publication...crRNA. This activity provides a stark contrast to Cas9 and Cpf1, which require that each DNA target have... Publication Plant ID Plasmid Gene/Insert PI Publication Do you have suggestions for other plasmids that...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...developments with CRISPR-Cas9 gene editing have propelled both reverse and forward genetics of these parasites...parasites. Moreover, CRISPR-dCas9 gene regulation has also been established for some of these parasites. Together... these tools have enabled precise genetic analyses to pinpoint genes linked to parasite virulence, transmission...occurs at a much lower efficiency than NHEJ. Plasmid Gene/Insert Selectable Marker PI Publication Libraries...10 guides against 8,158 predicted protein-coding genes. Do you have suggestions for other plasmids that...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...

... inactive Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable... throughout the chromosome. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...

...type or mutant ORFs, gene fragments, and gRNAs for genes linked to neurodegenerative disorders. Find plasmids...within the huntingtin (HTT) gene. An individual with the mutated HTT gene will have huntingtin proteins...association between a gene and late-onset AD. It is more likely a combination of gene variation and lifestyle... oxytocin receptors using an AAV-CRISPR/Cas9 strategy for gene editing across divergent rodent species... are associated with known genetic mutations in one of the following genes: SOD1, C9ORF72, TARDBP, FUS...three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of individuals...these additional genes may play in Alzheimer's disease. Research Tools Neurodegeneration Plasmid Collection...

...perspective, sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome... in control of gene expression so be sure to try a few different systems with your gene/protein of interest...Technique PI Purpose pCas9 42876 CRISPR Luciano Marraffini Bacterial expression of Cas9 nuclease gRNA. For...Anhydrotetracycline inducible expression of wild-type Cas9 from S. pyogenes for inducing double stranded breaks. For...inducible expression of catalytically inactive Cas9 ( S. pyogenes ) which can be combined with expression of...Engineering Although overexpressing or knocking down a gene can tell you much about its function and/or alter...you're studying the basic biology of a bacterial gene or redirecting metabolic pathways to produce a therapeutic...

...constitutive overexpression of FPs and tagging of genes of interest with FPs in yeast. Characterization ... PGK1 promoters and the KanMX marker. ID Plasmid Gene/Insert Selectable Marker Publication Additional ...Yeast Localization and Overexpression (MyLO) CRISPR-Cas9 Toolkit Other Plasmids Bas Teusink Lab Materials... Vickers CE, Bydder SF, Zhou Y, Nielsen LK. Dual gene expression cassette vectors with antibiotic selection...