...CRISPR Libraries Cas9 Pooled Barcoding Libraries Control Addgene's lentiviruses are made from plasmids that...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone does not contain SpCas9. 76,441...,114 human genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled...76,441 unique sgRNAs along with 1000 non-targeting controls. This backbone contains SpCas9. SpCas9 and 76,...,114 human genes along with 1000 non-targeting controls Puromycin Doench , Root Human activation pooled...57,050 unique sgRNAs along with 500 non-targeting controls. This backbone does not contain dCas9. 57,050 ...18,901 human genes along with 500 non-targeting controls Puromycin Doench , Root 92386 Human CRISPR inhibition...

...function under a wide range of highly controlled conditions in vitro , or, if you want to determine its ...Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter Plasmids...Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may also like… ...produce large amounts of this protein and study it in vitro ? These, in addition to many questions about bacteria..., sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome...Manipulating the genome directly can give you more subtle control over protein expression and activity thereby limiting...Dammeyer Lactose/IPTG inducible vectors with LacIq, a stronger repressor than LacI that lowers basal protein ...

... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...are initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...

... in search of inducible promoters capable of controlling eukaryotic gene expression. Several endogenous... regulator of gene expression, a tetracycline-controlled transactivator (tTA) was developed. tTA was created... transactivator rtTA ( r everse t etracycline-controlled t rans a ctivator) was created by fusing rTetR...and additional plasmids tetR-KRAB On Aebischer & Trono 16542 pBI-MCS-EGFP Expression of your gene of interest...Puro_Tet3G_3xFLAG_Twin_Strep Bidirectional promoter controls expression of gene of interest with Strep-Tag ...Blast (w756-1) Lentiviral reverse tetracycline-controlled transactivator 3 (rtTA3) expression vector, CMV... 3rd generation rtTA On Campeau 25434 pMA2640 Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin...

...facilitation, DNA amplification, and high-quality quality control measures such as titering, purity assessment, sterility...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy ...centrifugation purification Addgene’s comprehensive quality control process: Titering Purity assessment Sterility testing...produce the prep, and perform comprehensive quality control processes to make sure it is ready for your experiments...your AAV vector experience, from methods to troubleshooting insights, you make research more reproducible...gap between published methods and real-world troubleshooting. Eligible Plasmids The following plasmids are...including purification, titration, and quality control measures. We have distributed preps around the ...

...given donor-acceptor pair, the FRET efficiency strongly depends on the distance between the donor and ...linker-Cerulean-5aa linker-Venus-6aa linker-Venus V5V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 5 amino acid linker V17V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 17 amino acid linker V32V Anisotropy/brightness standard consisting of two Venus fluorescent...proteins connected via a 32 amino acid linker VVV Anisotropy/brightness standard consisting of three Venus... 5 and 6 amino acid linker, respectively VVVV Anisotropy/brightness standard consisting of four Venus ...5 and 6 amino acid linker, respectively VVVVV Anisotropy/brightness standard consisting of five Venus ...

...expression. γ-Retrovirus Plasmids | Guide γ-retroviruses, commonly referred to as retroviruses, are the most...integration. Community Resources Nolan Lab Retroviral Systems Trono Lab Lentivector Toolbox Guide to Generating...Adenoviruses are commonly used as vaccines because of the strong immunogenic response they induce. Some (oncolytic...this infectivity is limited to dividing cells. Retroviruses integrate permanently into the host genome, ...virus (as happens in nature), researchers can introduce plasmids to a host to generate virus. Furthermore...DNA >8 Kb 105 Dividing/Non-dividing No High γ-Retrovirus Stable RNA <8 Kb 80-130 Dividing Yes Moderate...

...Image from Fenno et al., 2014. INTRSECT INTRSECT (intronic recombinase sites enabling combinatorial targeting...and Flp) recognition sequences within synthetic introns. INTRSECT was first shown as a proof-of-concept...transgenic recombinase-expressing animal lines and retro-grade expressing viruses delivering additional recombinases.... Figure 2: INTRSECT works by inserting short, intronic sequences into the open reading frame (ORF) of...sequences (e.g. Lox sites, FRT sites) inside of the introns (A,D). The addition of these recombinase recognition...recognition sequences enables directional control of the portion of the ORF that is sandwiched between the... combinations of recombinases are present, the introns are excised during mRNA processing, producing a...

...Varies pBABE GFP - Retroviral gene expression pMKO.1 GFP - Retroviral shRNA... page . Retroviral Easy and safe to use pBabe plasmids - Mammalian retroviral gene ... retroviral shRNA expression MSCV-IRES-GFP - Mammalian retroviral gene expression...Tet-inducible lentiviral shRNA expression pMKO.1 puro - Retroviral shRNA expression pLenti CMV Puro... marker LZRS-Rfa or pMXs-gw - Mammalian retroviral Gateway cloning vectors Adenoviral...mammalian gene silencing pMKO.1 puro - Retroviral plasmid for mammalian gene silencing...

...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...

... Cut Fully functional CRISPR/Cas enzymes will introduce a double-strand break (DSB) at a specific location...frameshifts, creating loss of function alleles. To introduce specific genomic changes, researchers use ssDNA...PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted single-strand breaks in DNA instead...mutants can also be used with a repair template to introduce specific edits via homology-directed repair (HDR...49410 pCFD3-dU6:3gRNA dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion none, need Cas9 plasmid ...

... optimized dcas9 gene under the control of Murine Stem Cell retroVirus LTR promoter. The second plasmid...pgRNA_humanized ) contains a murine U6 promoter controlled sgRNA cassette, wherein the GN19 can be custom...as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Qi LS, Larson MH, Gilbert LA...vector (Leu2) that contains dCas9 fused to NLS controlled by TDH3 promoter 46921 pTDH3-dCas9-Mxi1 Yeast...and sgRNA targeting GAL4 UAS promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector...Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1...Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE ...

...telangiectasia Didier Trono 14581 pSUPER.ATMi ATM H1 Ataxia telangiectasia Didier Trono 14666 pQE9-His-p97...T7 Parkinson's Dmytro Yushchenko 107293 s2. pT7-7-SNCA-5Asp SNCA T7 Parkinson's Dmytro Yushchenko 107294... T7 Parkinson's Dmytro Yushchenko 107295 r. pT7-7-SNCA-5Asn SNCA T7 Parkinson's Dmytro Yushchenko 107296...T7 Parkinson's Dmytro Yushchenko 107297 r-22. pT7-7-SNCA-9Asn SNCA T7 Parkinson's Dmytro Yushchenko 107425...neuroaxonal dystrophy Michael Ward 178167 RNF216_Halo_C_allele RNF216 Halo Hypogonadotropic hypogonadism...Ataxia Pietro De Camilli 194005 VPS13D1-1576-(Y1253S) VPS13D GFP CMV Spinocerebellar Ataxia Pietro De Camilli...research related to Alzheimer's Disease (AD), Amyotrophic Lateral Sclerosis (ALS), Frontotemporal dementia...

... 10 6 cells in 100 μl of electroporation solution and add to electroporation cuvette. Add 5 μg of each...construct. Electroporate cells with 250 volts for 5 msec in a 2 mm cuvette using an electroporation system...of culture media after electroporation. Minimize the time between electroporation and transferring the ...manuscript here: Bauer et al, 2014 322.2 KB If you have trouble loading this video, please try viewing on YouTube...involves the delivery of CRISPR/Cas9 plasmids by electroporation 4 . This protocol is described in detail for...Li D, Li J. Cell Stem Cell . 2013. PubMed . Electroporation: theory and methods, perspectives for drug ...

...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype ...fluorescent reporters and can be used to compare the tropism of different serotypes. In addition to the standard...list of all 100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized... catalog item, including the titer and quality control, visit the material page (linked for each catalog...AAV9 37825-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP...AAV9 50465-AAV9.T 20 µL $ 140 Add to Cart AAV Retrograde 50465-AAVrg.T 20 µL $ 140 Add to Cart *Each viral...

...26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG 68255 cut S. pyogenes 26616834 Patron leu2 S. ...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens... 26616834 Patron PM19 H. vulgare GGCTGGCGTTGGTCGTAACA 68254 cut S. pyogenes 26616834 Patron Prnp M. musculus...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

... of control AAV vectors for trial purposes in serotypes AAV1, 2, 5, 8, 9 and retrograde Retrograde AAV...is used in a wide range of experiments, both in vitro and in vivo. It has low immunogenicity, is easy .... Addgene’s comprehensive high-quality quality control process includes titering, purity assessment, sterility... Sensors, Glutamate Sensors, Voltage Reporters Controls Fluorescent Proteins, Spagehetti Monster, Brainbow...

...practical advice for designing your gRNA and introducing it into cells. Protocol for Genomic Deletions...stickleback, tobacco, tomato, frog ( X. laevis and X. tropicalis ), and zebrafish. Off-Spotter: tool for CRISPR... mouse, rat, marmoset, pig, chicken, frog (X. tropicalis and X. laevis), zebrafish, sea squirt, Drosophila...104.1 KB Chen and Wente Zebrafish: gRNA cloning, in vitro transcription, injection gRNA core ; Cas9 ; optimized...Fujii gRNA design and cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP)... packaging plasmids: pVSVg , psPAX2 ; positive control: CMV-EGFP PDF 2.3 MB Zhang GeCKO pooled library...lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control: CMV-EGFP Kits are also available (mouse or human...

...gRNAs with the Cas9 nickase which will together introduce cleavage of the target site with efficiency similar...on each side flanking the change you'd like to introduce. We use Ultramer oligo from IDT (non-PAGE purified...although this might still be okay if you are introducing a selection marker gene. The homology arms should...ideally less than 10bp away if possible. For introducing small mutations (<50bp) or a single-point mutation...around 100-150bp total homology. The mutation is introduced in the middle, giving 50-75bp homology arms. ...double digestion. As a successful insertion will destroy the BbsI sites, a double digest should discriminate...BbsI and AgeI will be able to cut). After the introduction of a mutation into the genome, how can cells...

...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...repaired DSBs): For small nucleotide edits that introduce a novel restriction site. The region of interest...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80...