Skip to main content
Addgene
Showing: 21 - 40 of 79 results
  1. University of Florida Serotype Testing Panel for the Eye and Brain

    Type
    Collection
    ... Viral Vector Packaging Service AAV University of Florida Serotype Testing...Testing Panel for the Eye and Brain Viral Vector Packaging Service: University of Florida Serotype Testing... directly to the brain parenchyma or subretinal space Serotypes The following serotypes were developed...acknowledge Shannon Boye and cite Boye, et al. 2016. Impact of Heparan Sulfate Binding on Transduction of Retina...32304666 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  2. AAV Viral Preps

    Type
    Collection
    ... (AAV) available from Addgene's viral vectory packaging service. Browse constructs currently available... Viral Vector Packaging Service AAV Browse In-Stock AAV Adeno-associated virus (AAV...can't find the prep you need, try Addgene's AAV Packaged on Request service. You can choose a transfer ...transfer plasmid from our repository and request packaging in one of five serotypes (AAV1, AAV2, AAV5, AAV8, ... For more information, visit our Viral Vector Packaging Service overview. Function Chemogenetics DREADDs...
  3. Viral Prep Service for Plasmids and Pooled Libraries

    Type
    Collection
    ...Browse Lenti Packaged on Request Can't find what you need in our in-stock preps? Our Packaged on Request...the viral vector prep you need. Packaged on Request Viral Vector Packaging Service Information Production... Viral Vector Packaging Service Addgene produces high-quality viral vector...
  4. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...Plasmids Envelope and Packaging Plasmids Popular Lentiviral Envelope and Packaging Plasmids Popular γ-Retrovirus...leukemia virus, and vesicular stomatitis virus G) are packaged as replication-defective virus particles with ...SARS-CoV-2 and other coronaviruses using appropriate packaging plasmids. Use the search bar to find a particular...-Retrovirus Envelope and Packaging Plasmids Reporter Plasmids A few examples of reporter plasmids that...
  5. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...protein Selectable markers Viral expression and packaging Reporters, shRNA expression, transgenics and ... lab collection for more) pLexA and pACT2.2 - Yeast 2-hybrid plasmids Fly UAS... expression under the metallothionein promoter pACU2 - Modified pUAST vector containing...InvivoGen trademark. Back to Top Viral Expression and Packaging Although transient expression is sufficient for...extensive collection of plasmids for packaging and expression. See our dedicated lentiviral plasmid...
  6. Optogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics ...Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus Constitutive 1, 9... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  7. Validated gRNA Sequences

    Type
    Collection
    ...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....
  8. Caltech Systemic Capsids

    Type
    Collection
    ... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service: Caltech...CAP-B22 AAV9-X1.1 As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use...window) Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  9. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...
  10. AAV Molecular Tools

    Type
    Collection
    ... Viral Vector Packaging Service AAV Molecular Tools Viral Vector Packaging Service: Molecular Tools..., Wells Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  11. Serotype Testing AAV

    Type
    Collection
    ... Viral Vector Packaging Service AAV Serotype Testing AAV Viral Vector Packaging Service: Serotype ...order it? Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  12. Recombinases AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Recombinases Viral Vector Packaging Service: Recombinases ... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  13. AAV for Neuronal Tracing

    Type
    Collection
    ... Viral Vector Packaging Service AAV Monosynaptic Neuronal Tracing Viral Vector Packaging Service: Tools...17329205 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  14. Chemogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics...Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  15. Lentiviral Prep Service

    Type
    Collection
    ...details about our viral vector packaging service, visit our Viral Vector Packaging Service page . Pooled CRISPR...lentivirus available from Addgene's viral vector packaging service. Browse constructs currently available... Viral Vector Packaging Service Lentivirus Browse In-Stock Lentivirus Pooled CRISPR...
  16. Viral Vectors

    Type
    Collection
    ...host genome. AAVs are limited by their small packaging capacity. Adenovirus Plasmids | Guide Adenoviruses...type, linked above. Virus Expression Genome Packaging Capacity Virus Size (nm) Cells Infected Target Cell...
  17. Control AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Controls Viral Vector Packaging Service: Control AAV Browse... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  18. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... Viral Vector Packaging Service Penn Vector Core Transfer Viral Vector Packaging Service: Penn Vector...Optogenetics Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda AV-1-...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-9-20071P 20071-AAV9 pACAGW-ChR2-Venus-AAV Optogenetics Karel Svoboda AV-9-...-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2-Venus-AAV Karel Svoboda AV-5-20949P 20949-...
  19. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fisher 26402 pF141 pAcGFP1 SOD1WT SOD1 GFP CMV ALS Elizabeth Fisher 26403 pF142 pAcGFP1 SOD1 A4V SOD1 GFP...Fisher 26404 pF143 pAcGFP1 SOD1G37R SOD1 GFP CMV ALS Elizabeth Fisher 26405 pF144 pAcGFP1 SOD1G85R SOD1 GFP... GFP CMV ALS Elizabeth Fisher 26406 pF145 pAcGFP1 SOD1G93A SOD1 GFP CMV ALS Elizabeth Fisher 26407 pF146...Prnp_SAM2 PRNP U6 Dementia Walker Jackson 79259 pAc5.1B-lambdaN-HA-DmeIF4G-V5His6 EIF4G1 His, HA, V5 Ac5...IDR-mCherry TBP Parkinson's Denes Hnisz 146392 pAc5.1B-lambdaN-HA-DmeIF4G-trunc-V5His6_G EIF4G His, HA...HA, V5 Ac5 Parkinson's Elisa Izaurralde 146493 pAc5.1B-lambdaN-HA-DmeIF4Ga-Nterm_H EIF4G His, HA, V5 Ac5... Ac5 Parkinson's Elisa Izaurralde 146577 pAc5.1B-lambdaN-HA-DmeIF4Ga-dsRNAres_I EIF4G His, HA, V5 Ac5 ...
  20. Retrograde AAV viral preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Retrograde AAV Viral Vector Packaging Service: Retrograde AAV...Berkeley). Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
Showing: 21 - 40 of 79 results