... that has a different emission wavelength. For example, if the marker protein is fused to GFP, you may...with their own unique function. The nucleus, for example, houses the cell’s genetic material. The mitochondria...Fusions to other FPs can be found by searching the complete Michael Davidson Fluorescent Protein Collection...

...Collection INTRSECT Plasmid Collection INTRSECT Implementation Plasmids References The development of powerful...populations defined by multiple parameters. Figure 1: Examples of intersectional cell population definitions ...order to enable three-feature cell targeting. C) Example of viral targeting of cells expressing Cre AND ...producing a functional molecular tool (C,F). Implementation The following resources may be of interest ...interest for groups interesting in implementing intersectional experimental design. The Deisseroth Lab maintains...

...parts can be combined to construct complex networks. This is accomplished through the use of assembly standards...meaning that the suffix will need to be reverse complimented for primer design. The restriction enzymes used...encodes Gly-Ser in-frame with prefix start codon; Employs high-efficiency enzymes. Prohibited Restriction...

...pAAV-synP-FLEX-splitTVA-EGFP-B19G Can be used to complement deletion-mutant rabies virus AAV1 Wickersham ...pAAV-syn-FLEX-splitTVA-EGFP-tTA These AAV together can be used to complement deletion-mutant rabies virus AAV1 Wickersham ...lacks the ability to infect neighboring cells. For example, G-deleted rabies lacks the viral glycoprotein...infect any neighboring cells. Thus, through complementation, G-deleted rabies virus can spread to monosynaptically...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication...

...Insert PI Kits Kit name Type PI Description High Complexity Golden Gate Assembly Standards Kit Cloning Eric...allowed to use for distribution. Please see the Sample Agreements on our Technology Transfer Information...Scientist Acknowledgement (RSA). This form can be completed electronically by the scientist who will be using...using the materials in the order. After the RSA is complete, Addgene will send you a copy of the MTA, which...

...microscope, or detect when the protein is present in a sample--just to name a few. Traditional sources of antibodies...individual clone targeting a single antigen. An example of R-mAbs is the NeuroMab collection - monoclonal...single-domain antibodies (also known as nanobodies). For example, scientists often use plasmids encoding scFv fragments...recombinant antibody fragments in the form of scFvs A simple vector system to improve performance and utilisation...

...ARF GTPase family, information on each gene, and examples of plasmid types available for each gene. Click...request. Family Gene Entrez Gene ID Length (aa) Example Expression Systems GTPase Arf1 375 181 Bacterial... and GEF family, information on each gene, and examples of plasmid types available for each gene. Click...request. Family Gene Entrez Gene ID Length (aa) Example Expression Systems GAP Arfgap1 55738 414 Bacterial...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication...

...Figure 2: Simplified representation of the Voytas/Bogdanove Golden Gate TALEN kit. In this example, the final...bind adenenine with lower specificity). With the template for studying this type of technology already laid... bp. TAL effectors have some restrictions (for example, the target must start with a T), but they still...

...Viruses used to direct these alternate functions simply have to harbor alternate viral genomes, such that... wide array of genetic functions in cells. For example, if there is a protein thought to be associated...typical plasmid and thus can be easily modified and amplified (through standard cloning methods). There are ..., are suited for specific research goals . For example, adeno-associated virus (AAV) is typically preferred...

... Expression mPlum 590 649 4 4.5 100 min Monomer pQC mPlum IX - Mammalian Expression mPlum-N1 - Mammalian...Mammalian Expression mPlum-C1 - Mammalian Expression mPlum-pBAD - Bacterial Expression mRaspberry 598 625 13...

...assess protein-protein interactions. NanoLuc® complementation : Protein-protein assays based on a split NanoLuc...more. nLuc/cLuc for split Firefly Luciferase complementation in plants. Bioluminescence Resonance Energy...Firefly luciferase fragment for split-luciferase complementation assay in plants using Gateway cloning. Use ...Fifrefly luciferase fragment for split-luciferase complementation assay in plants using Gateway cloning. Use ...

...techniques, including that it is easy to implement due to the simplicity of gRNA design, programmable for different...copies of labeled proteins to the given region. For example, chromosome-specific repetitive loci can be efficiently...

...sites. Design oligos based on the following template: example : Resources: Protocol for generating gRNAs...cleavage sites, while the addition of an ssODN donor template can mediate gene replacement by homologous recombination...

...Cascade ( C RISPR- as sociated c omplex for a ntiviral de fense) complex, comprised of a combination of ...difficulties in getting all components of the Cascade complex to express equally. To combat this, some CRISPR-Cas3...

...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...edit close to the gRNA PAM site. When a repair template is present, the cell may repair a DSB using homology-directed...Nickase mutants can also be used with a repair template to introduce specific edits via homology-directed...

...below and not included in this table. For a more complete list of plasmids that can be used in worms, search...backbones, and constructs for endogenous tagging. Some examples of useful worm CRISPR resources, along with links...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...

...the Cas9 application the gRNA was designed to accomplish. Validated gRNA Sequence Datatable Target Gene...musculus 64071 cut S. pyogenes 25337876 Ventura Amplicon, JAK2 H. sapiens GAGGCATATTCTTCTCCTGG 70660 cut...GCGCTTACACTTTAGGAGACACTC 61080 purify S. pyogenes 25051498 Fujii JAK2 amplicon H. sapiens GGTTTAATGGAAGAGAAGGG 70679 cut S. pyogenes... 70018 cut S. pyogenes 26541286 Voytas BCR/ABL amplicon H. sapiens GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes...

...and restores visual function in a mouse model of complete congenital stationary night blindness. Hum Mol...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495....