...Bacterial systems were tested for functionality in mammalian cells. The lac system with the inducer isopropylthio-β-galactoside... Gossen and Bujard tested the tet system in a mammalian cell system (HeLa) and found that the tet system...promoters are developed by placing a TRE upstream of a minimal promoter. Tetracycline Off System The initial system...promoter (Pbi); Pbi contains a TRE between two minimal CMV and is silent in absence of binding of tTA ...knockdown of gene expression at a single copy in mammalian cells; Expresses firefly luciferase hairpin and...References Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Gossen...

...affecting females at an incidence of approximately 1:10,000. It is characterized by apparently normal development...Syndrome Plasmid Collection and Resource Center MECP2 Animal Models Human Cell Lines CRISPR Tools Plasmids Resources...criteria, defined as the presence of relatively normal early development, regression with a loss of spoken... rare cases Rett syndrome can be inherited. In females, random X inactivation results in approximately...PMID: 21074045 2017 - the Bird lab determines a minimally functional MECP2 that rescues neurological defects...opens in a new window) PMID: 29019980 Return to top Animal Models Studies of the MECP2 protein in mouse and...general introduction to CRISPR technology or the mammalian CRISPR resources for a full selection of plasmids...

... nuclease domains: pST1374 (for expression in mammalian cells or zebrafish) pDW1775 (for expression in... domain. Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish (can be used as a substitute...domain ( Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish). pMLM802 (for expression of...domain ( Miller et al., Nat Biotech 2007 ) in mammalian cells or zebrafish). pMG10 (a '“2-in-1” ZFN cassette...domain ( Sollu et al., Nucleic Acids Res ) in mammalian cells or zebrafish). pCLR2068 (for expression ...domain. ( Doyon et al., Nat Methods 2011 ) in mammalian cells or zebrafish as described by Moore et al...

...2013, Cong et al. and Mali et al. described CRISPR-based genome editing in mammalian cell culture. Five ... specialized Cas proteins snip foreign DNA into small fragments approximately 20 bp in length and paste...characterized. Staphylococcus aureus (SaCas9) is smaller than SpCas9 and more easily packaged in AAV. Cas9... improving targeting in AT-rich genomes. Cpf1's small size also makes it suitable for multiplexing and...permanent genome edits or double-strand breaks. In mammalian cells, Cas13-ADAR2 does not require a specific... this non-specific cleavage does not occur in mammalian cells. Purify : Epitope-tagged dCas9 can also ...has CRISPR plasmids for the following models: Mammalian systems (Human, mouse, and rat) Bacteria ( E. ...

...are sporadic, having no prior family history. A small percentage (5-10%) are familial ALS cases having...These familial cases, usually inherited in an autosomal dominant manner, are associated with known genetic... Disease Huntington’s disease (HD) is a fatal autosomal dominant genetic disorder that causes the progressive...difficulty speaking and swallowing. HD is caused by abnormal expansion of a repeating CAG triplet series within...mutated HTT gene will have huntingtin proteins with abnormally long polyglutamine sequences. These glutamine-rich...medication and surgery. PD primarily involves the malfunction and death of dopamine-producing neurons in the... specific known cause) nature of the disease, a small portion of cases can be attributed to known genetic...

...(SARS classic) sequences. Mammalian Targets : Plasmids containing mammalian sequences linked to SARS-CoV...Return to top Plasmids Encoding Mammalian Genes or Inserts Several mammalian genes have been identified as...protein constructs for making VSV pseudo virus Mammalian constructs Due to the size and complexity of the...entry into cells. ( 4 ) Cathepsin L - a cysteine endosomal protease that triggers proteolysis of SARS-CoV...plasmids from Andrew Ellington's lab. High-surety isothermal amplification and detection of SARS-CoV-2, including...Andersen, KG, et al, 2020, Nature Medicine The proximal origin of SARS-CoV-2 . TMPRSS2 - Hoffmann M, et...Andersen, KG, et al, 2020, Nature Medicine The proximal origin of SARS-CoV-2 . BSG - Wang, K et al, 2020...

...sources of antibodies for research purposes include animals or hybridoma cells, but are difficult to generate...into plasmids and expressing these in bacteria, mammalian cells, yeast, plants, or insect cells. Benefits...recombinant monoclonal antibodies (R-mAbs) expressed in mammalian cells. Monoclonal antibodies are derived from ...the plasmids are transiently transfected into mammalian tissue culture cells, the R-mAbs are secreted ...use. Other scientists may choose to work with a smaller fragment of an antibody, which could offer increased...increased stability and ease of production due to their small size. These recombinant antibody fragments can be...antibody heavy- and light-chain DNAs into a single mammalian expression vector A tool kit for rapid cloning...

...DHLAG, HLADG, Ia-GAMMA CD8A CD8a molecule CD8, Leu2, MAL, p32 CD8B CD8b molecule CD8B1, LYT3, Leu2, Ly3, MGC119115...cytotoxicity triggering receptor 3 1C7, CD337, LY117, MALS, NKp30 NFAT5 nuclear factor of activated T-cells...TRAP, gp39, hCD40L CD8A CD8a molecule CD8, Leu2, MAL, p32 CD8B CD8b molecule CD8B1, LYT3, Leu2, Ly3, MGC119115... HSCR, HSCR2 EGF epidermal growth factor (beta-urogastrone) HOMG4, URG EGFR epidermal growth factor receptor...Categories Plasmid Tables Additional Resources Mammalian organisms are exposed to millions of potential...Chemokines Chemokines, or chemotactic cytokines, are small proteins that can be secreted by immune cells and...X-associated protein - SHFM1 split hand/foot malformation (ectrodactyly) type 1 DSS1, ECD, SEM1, SHFD1...

...RPS6KA2 RPS6KA3 RPS6KA6 Ribosomal protein S6 kinase RPS6KB RPS6KB1 RPS6KB2 Ribosomal protein S6 kinase B1...collection of plasmids for the Ras pathway. Ras is a small GTPase and constitutively active Ras is the most...Plasmids Ras Gene List Resources Background Ras is a small GTPase and is a member of the G protein (guanine...addition and removal of a phosphate group. Under normal physiological conditions GTPases play prominent...factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1 EIF4EBP2...Ras-related C3 botulinum toxin substrate (rho family, small GTP binding protein Rac) RAF AFAF BRAF RAF1 Serine...

...localization. ACP and MCP tags ACP- and MCP-tags are small protein tags based on the acyl carrier protein. ...SNAP-tag Empty backbone for stable and transient mammalian expression 101133 pSNAP-CaaX Control Plasmid SNAP-tag...CLIP-tag Empty backbone for stable and transient mammalian expression 101134 pCLIPf-H2B Control Plasmid CLIP-tag...Vector ACP/MCP-tag Empty backbone for transient mammalian expression 101126 pACP-tag (m)- 2 Vector ACP/MCP-tag...MCP-tag Empty backbone for stable and transient mammalian expression 101132 pMCP-GPI Control Plasmid ACP... Marahiel MA.1998. Peptide bond formation in nonribosomal peptide biosynthesis. Catalytic role of the ...

... that function in mammalian cells can be used to attentuate RNA levels. In mammalian systems, Cas13a does...available for expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

...for expression in mammalian systems, bacteria, plants, yeast, and zebrafish. Mammalian ID Plasmid Gene/...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...and they can convert cytidine to uridine within a small editing window near the PAM site. Uridine is subsequently...editors are designed to work in a very narrow window proximal to the PAM sequence, some base editing systems...

...GRE or transgenic animal Oligodendrocytes - AAV-PHP.eB with GRE or transgenic animal Brain vascular cells...GRE or transgenic animal L5 & Inhibitory - AAV-PHP.eB with GRE or transgenic animal L2/3 & L4 - AAV.CAP-B10...with GRE or transgenic animal Excitatory - AAV.PHP.N with GRE or transgenic animal For PNS applications ...

...fluorophore and targeted to the neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 107708...channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by...export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome...genetically encoded dopamine sensor RdLight1 in mammalian cells. Lin Tian 125708-AAV9 pAAV-hSynapsin1-RdLight1...genetically encoded dopamine sensor RdLight1 in mammalian neurons. Lin Tian 127090-PHPeB pAAV-CAG-DIO-ChR2... in AAV production vector expressed under the mammalian promoter (EF1a) Francois St-Pierre 179460-AAV1...AAV production vector under the control of the mammalian promoter (EF1a) Francois St-Pierre 179463-AAV9...

...into cells. Protocol for Genomic Deletions in Mammalian Cell Lines CasPEDIA : An encyclopedia of Class...tool for CRISPR/Cas design Program for designing optimal gRNAs. Provides feedback on number of potential...PAMs. Currently supports: mouse and human. CRISPR Optimal Target Finder Tool from the O'Connor-Giles Lab ...cloning pCRISPR PDF 106.7 KB Mendenhall & Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor...Orkin and Bauer Protocol for Genomic Deletions in Mammalian Cell Lines pSpCas9(BB) (pX330) Link Parrott NEBuilder...

...for CRISPR plasmids for RNA editing in mammalian systems. Mammalian ID Plasmid Gene/Insert PI Publication...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...truncation retain RNA editing capabilities but are small enough to be packaged in AAV particles. Want more...

...are available for expression in mammalian systems and bacteria. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish... used in bacteria genome editing, though some mammalian systems have been developed. Figure 1: Overview...

...nuclease system to facilitate genome editing in mammalian cells (Cong et al ., Science 2013, Ran et al ....Plasmids The CRISPR/Cas system can be implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9... are two sets of 3 vectors each available for mammalian endogenous gene activation using SAM: Addgene ...adeno-associated virus (AAV). The single vector system uses a smaller Cas9 from S. aureus (SaCas9) that has been human...In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich...

...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ...

...AAV Plasmids Adeno-associated viruses (AAV) are small viruses originally discovered as contaminants of... The utility of AAV is currently limited by its small packaging capacity (∼4.5 kb including ITRs), though... the N587 residue replaces with a TAG stop codon Mali 130878 pAAV-DJ-N589X AAV-DJ-N589X Encodes the AAV-DJ... the N589 residue replaced with a TAG stop codon Mali 166921 AAV-F in pAR-9 AAV-F AAV rep/cap plasmid....