Skip to main content
Addgene
Showing: 1 - 20 of 43 results
  1. Synthetic Biology - Fungal

    Type
    Collection
    ... Plasmid Collections Synthetic Biology Fungal Synthetic Biology: Fungal SynBio Resources...collection of synthetic biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort... for use in fungus. Plasmid...
  2. Joung Lab CRISPR-Cas/RNA-Guided Nuclease (RGN) Plasmids

    Type
    Collection
    ...Joung Lab CRISPR-Cas/RNA-Guided Nuclease (RGN) Plasmids... Genome Engineering CRISPR Joung Lab CRISPR Plasmids...Plasmids Joung Lab CRISPR-Cas/RNA-Guided Nuclease (RGN) Plasmids You may also like... CRISPR Guide CRISPR... endonuclease) that cleaves the target DNA. The Joung lab recently described gRNA and Cas9 expression ...Hwang and Fu et al., Nat Biotechnol. 2013). The Joung lab has also modified their web-based ZiFiT Targeter...newsgroup here . Links to additional pages describing Joung Lab CRISPR-Cas/RGN reagents: Cpf1 expression plasmids...
  3. Validated gRNA Sequences

    Type
    Collection
    ...pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243 cut S. pyogenes 23360964 Joung GABPA H. sapiens...pyogenes 23360964 Joung RNF2 H. sapiens GTCATCTTAGTCATTACCTG 47509 cut S. pyogenes 23792628 Joung rol-6(su1006...pyogenes 23360964 Joung tph1a D. rerio GGGAAAACACAACCGCAGCC 42249 cut S. pyogenes 23360964 Joung TRE3G H. sapiens...pyogenes 23792628 Joung VEGF H. sapiens GGGTGGGGGGAGTTTGCTCC 47505 cut S. pyogenes 23792628 Joung VEGF H. sapiens...GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes 23360964 Joung ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...GGAAACTACAGCCCAGCGTC 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut...
  4. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ..., cut S. pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter...Mammalian U6 none As Cpf1 Joung BPK3082 78742 Mammalian U6 none Lb Cpf1 Joung pLentiCRISPR-E 78852 Mammalian... meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus Joung BPK2101 65770 ...Goldstein DR274 42250 C. elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes... MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach...pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen) 48140 Mammalian BbsI yes, nick S...Wente DR274 42250 Zebrafish BsaI none S. pyogenes Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere...
  5. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Axel Brunger 12339 pBD-0071 VCP His T7 ALS Axel Brunger 12344 pBD-0010 VCP His T7 ALS Axel Brunger 12345...Axel Brunger 12346 pBD-0013 VCP His T7 ALS Axel Brunger 12347 pBD-0006 VCP His T7 ALS Axel Brunger 12348...Axel Brunger 12349 pBD-0070 VCP His T7 ALS Axel Brunger 12350 pBD-0069 VCP His T7 ALS Axel Brunger 12351...Axel Brunger 12352 pBD-0007 VCP His T7 ALS Axel Brunger 12353 pBD-0018 VCP His T7 ALS Axel Brunger 12354...Axel Brunger 12355 pBD-0022 VCP His T7 ALS Axel Brunger 12356 pBD-0024 VCP His T7 ALS Axel Brunger 12357...Axel Brunger 12358 pBD-0035 VCP His T7 ALS Axel Brunger 12359 pBD-0039 VCP His T7 ALS Axel Brunger 12360...Axel Brunger 12361 pBD-0072 VCP His T7 ALS Axel Brunger 12362 pBD-0050 VCP His T7 ALS Axel Brunger 12363...
  6. Zinc Finger Consortium: OPEN Reagents

    Type
    Collection
    ...Reagents (Kit # 1000000013 ) Depositing Labs: Keith Joung This kit consists of plasmids and strains used to...and nonprofits only. You may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe... ML, Thibodeau-Beganny S, Sander JD, Voytas DF, Joung JK. Nature Protocols . 2009;4(10):1471-501. doi:...requires OPEN pools (available by request from the Joung lab) and the following reagents (listed below and...1997 ) and later modified by Pabo and colleagues ( Joung et al., PNAS 2000 ). The Oligomerized Pool ENgineering...protocol for practicing OPEN is available in the 2009 Joung Nature Protocols paper . How to Cite this Kit These... used in this publication was a gift from Keith Joung (Addgene kit # 1000000013)" For your Reference section...
  7. CRISPR Guide

    Type
    Collection
    ...specificity. 2018. Lee JK, Jeong E, Lee J, Jung M, Shin E, Kim YH, Lee K, Jung I, Kim D, Kim S, Kim JS. Nat Commun...in genome imaging.. 2018. Ma H, Tu LC, Naseri A, Chung YC, Grunwald D, Zhang S, Pederson T.. Nat Methods...Welch MM, Sousa AA, Harrington LB, Sternberg SH, Joung JK, Yildiz A, Doudna JA. Nature . 550(7676):407-... Abudayyeh OO, Lee JW, Essletzbichler P, Dy AJ, Joung J, Verdine V, Donghia N, Daringer NM, Freije CA,..., Bhattacharyya RP, Livny J, Regev A, Koonin EV, Hung DT, Sabeti PC, Collins JJ, Zhang F. Science . 356...Gootenberg JS, Abudayyeh OO, Franklin B, Kellner MJ, Joung J, Zhang F. Science . 358(6366):1019-1027. PMID:...Abudayyeh OO, Gootenberg JS, Essletzbichler P, Han S, Joung J, Belanto JJ, Verdine V, Cox DBT, Kellner MJ, Regev...
  8. TALEN Engineering

    Type
    Collection
    ...TALengineering Reagents Joung Lab TAL Effector Engineering Reagents You may also like... Keith Joung Lab plasmids...Reagents from the Keith Joung laboratory for engineering TAL effectors, including designed TALENs, and...plasmids Dan Voytas Lab plasmids CRISPR plasmids The Joung Lab has developed three platforms for engineering...pages describing these reagents are provided below: Joung Lab REAL Assembly TALEN Kit Individual REAL TALE...
  9. Dimeric CRISPR RNA-guided FokI Nuclease (RFN)

    Type
    Collection
    ...Joung lab Dimeric CRISPR RNA-guided FokI Nuclease (RFN)... CRISPR Joung Lab CRISPR Plasmids CRISPR-FokI ...FokI Nuclease ( RFN ) technology developed by the Joung lab ( Tsai et al., Nat Biotechnol. 2014 ). Use of...Biotechnol. 2014 . The ZiFiT Targeter program from the Joung lab can be used both to identify potential target...
  10. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...Welch MM, Sousa AA, Harrington LB, Sternberg SH, Joung JK, Yildiz A, Doudna JA. 2017. Enhanced proofreading...: 26456817 Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK. 2014. Improving CRISPR-Cas nuclease specificity...Pattanayak V, Prew MS, Tsai SQ, Nguyen NT, Zheng Z, Joung JK. 2016. High-fidelity CRISPR-Cas9 nucleases with...Gonzales AP, Li Z, Peterson RT, Yeh JR, Aryee MJ, Joung JK. 2015. Engineered CRISPR-Cas9 nucleases with ...Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. ...
  11. TALEN Plasmids and Kits

    Type
    Collection
    ...in multiple organisms. Dan Voytas Adam Bogdanove Joung Lab TAL Effector Engineering Reagents Assembly via...ligation. Validated in zebrafish somatic cells. Keith Joung Zhang Lab TALE Toolbox PCR/Golden Gate cloning method... cloning (LIC). Validated in human cells. Veit Hornung Musunuru/Cowan Lab TALEN Kit Kit comprised of 834... and mouse pluripotent stem cells. 48706 pTAL7b Joung Lab REAL Assembly TALEN Kit 49042 EMM65 Bradley ...
  12. Adeno-associated virus (AAV) Plasmids

    Type
    Collection
    ...pUCmini-iCAP-AAV9.452sub.LUNG1 AAV9.452sub.LUNG1 non-standard AAV2 rep-AAV9.452sub.LUNG1 cap plasmid with...controlled by a tTA-TRE amplification system for mouse lung transduction after intravenous injection Gradinaru...
  13. Guide RNA Expression Plasmids for EGFP

    Type
    Collection
    ...Joung Lab Guide RNA Expression Plasmids for EGFP... CRISPR Joung Lab CRISPR Plasmids EGFP gRNA CRISPR-Cas...Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/RNA-Guided...
  14. Guide RNA Expression Plasmids for Endogenous Human Genes

    Type
    Collection
    ...Joung Lab Guide RNA Expression Plasmids for Endogenous Human Genes... CRISPR Joung Lab CRISPR Plasmids Human...Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/RNA-Guided...
  15. Zinc Finger Consortium Reagents

    Type
    Collection
    ...deposited by Zinc Finger Consortium members like the Joung Lab, Voytas Lab, and Wolfe Lab... Consortium Reagents You may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe...zinc finger technology. Consortium members Keith Joung and Daniel Voytas have deposited at Addgene various...
  16. Guide RNA Expression Plasmids for Endogenous Zebrafish Genes

    Type
    Collection
    ...Joung Lab Guide RNA Expression Plasmids for Endogenous Zebrafish Genes... CRISPR Joung Lab CRISPR Plasmids...Protocols gRNA Design Tools CRISPR Blog Posts The Joung Lab recently described the use CRISPR-Cas/RNA-Guided...
  17. TALEN Expression Vectors

    Type
    Collection
    ...purchased together with the Joung Lab Individual REAL TALE Repeat Plasmids in the Joung Lab REAL Assembly TALEN... REAL-Fast and FLASH You may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids CRISPR plasmids...
  18. Individual REAL TALE Repeat Plasmids

    Type
    Collection
    ...may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids The Joung Lab recently described ...available individually or as a set as part of the Joung Lab REAL Assembly TALEN Kit , which also includes...
  19. CRISPR-Cas/RGN expression plasmids for Zebrafish

    Type
    Collection
    ...Joung lab CRISPR-Cas/RGN expression plasmids for Zebrafish... CRISPR Joung Lab CRISPR Plasmids Zebrafish...RNA-Guided Nuclease ( RGN ) technology in zebrafish. The Joung Lab has demonstrated the use of these vectors to...
  20. Microbiology Resources

    Type
    Collection
    ...interest, including bacteria, viruses, protozoa, fungi, and more. ...bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below for the species you work with...Plasmids for Cyanobacteria Cyanobacteria Plasmids for Fungi Species Aspergillus sp. Cryptococcus sp. Plasmids...
Showing: 1 - 20 of 43 results