...MORF Feng Zhang - Multiplexed Overexpression of Regulatory Factors (MORF) Collection You may also like.....

...BiLAMP5e3 dTomato/nlsdTomato Control Fishell 213936 pAAV_BiPVe4_dTomato_nlsdTomato BiPVe4 dTomato/nlsdTomato...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...Control AIBS , Ting 213814 pAAV_BiSSTe10_dTomato_nlsdTomato BiSSTe10 dTomato/nlsdTomato Control Fishell 213829...213829 pAAV_BiCHATe27_dTomato_nlsdTomato BiCHATe27 dTomato/nlsdTomato Control Fishell 213855 pAAV_BiVIPe4...BiVIPe4 dTomato/nlsdTomato Control Fishell 213914 pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato BiLAMP5e3...Control Fishell 213940 pAAV_BiPVe3_dTomato_nlsdTomato BiPVe3 dTomato/nlsdTomato Control Fishell 213944...

...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...encoded Calcium indicators (GECOs) An Expanded Palette of Genetically Encoded Ca2+ Indicators. Science. 2011...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal...fluorescent cAMP indicator (Flamindo2) Genetically-encoded yellow fluorescent cAMP indicator with an expanded...protein-based cAMP indicator (Pink Flamindo) Red fluorescent protein-based cAMP indicator applicable to optogenetics...

...83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV2 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV5 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV9 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAVrg pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83896-AAV1 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...83896-AAV9 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...

...-EYFP Syn Activator Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics...Norepinephrine Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...Flp-dependent Control Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO...Control Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP...107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression with simultaneous dTomato expression Recombinases ...AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f and physically separate nuclear dTomato Calcium sensor Ting 51083...

...Gradinaru 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Gradinaru 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Gradinaru 213936-PHPeB pAAV_BiPVe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by chandelier...213914-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato AAV construct expressing dTomato driven by Lamp5...Gradinaru 213855-PHPeB pAAV_BiVIPe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by VIP interneuron-targeting...Gradinaru 213829-PHPeB pAAV_BiCHATe27_dTomato_nlsdTomato AAV construct expressing dTomato driven by cholinergic...Gradinaru 213814-PHPeB pAAV_BiSSTe10_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...

...MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin receptor 1 SRIF-2 SSTR2 somatostatin receptor 2 - SSTR5... IREL RFX5 regulatory factor X, 5 (influences HLA class II expression) - RFXANK regulatory factor X-associated...kinase, regulatory subunit 1 (alpha) GRB1, p85, p85-ALPHA PIK3R2 phosphoinositide-3-kinase, regulatory subunit...PLAU plasminogen activator, urokinase ATF, UPA, URK, u-PA PLAUR plasminogen activator, urokinase receptor...CSH2 chorionic somatomammotropin hormone 2 CS-2, CSB, hCS-B CSHL1 chorionic somatomammotropin hormone-like...HMG1L2 HDGFRP3 hepatoma-derived growth factor, related protein 3 CGI-142, HDGF2 HGF hepatocyte growth factor...MSTN myostatin GDF8 MTNR1A melatonin receptor 1A MEL-1A-R, MT1 MTNR1B melatonin receptor 1B MEL-1B-R, MT2...

...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory dTomato Constitutive 1, 9, PHP.eB Dimidschstein 135631...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 27056...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell...

...25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato ASCL1 H...25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato Asip R....pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC...25619936 Sato IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato IL1RN H....25619936 Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted...25619936 Sato MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato MYOD1 H...25619936 Sato MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato NANOG H...

...expressed in excitatory neurons aCamKII AAV Yang 107738 pAAV-hSyn-Cre-P2A-dTomato Cre and dTomato hSyn AAV...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Mammalian Sato 122961 pcDNA3.1_PA-Cre-Y324F Catalytically inactive PA-Cre CMV Mammalian Sato 123128 pET-His-Cre...Bacterial Dunlop 135217 pDEST mfap4:icre-p2a-tomato iCre and tdTomato mfap4 Zebrafish Tobin 135618 pAAV-Sox2...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...

...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...

...from Addgene's viral service encoding tet-off transactivators and tools for affinity purification (TRAP)....Packaging Service: Molecular Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell ...Cell Ablation Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible... promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...

...tetracycline as a regulator of gene expression, a tetracycline-controlled transactivator (tTA) was developed...repression. The new transactivator rtTA ( r everse t etracycline-controlled t rans a ctivator) was created by...TetR On Geley Transactivators (tTA or rtTA) Find a construct that expresses the transactivator for your tetraycline... seven repeats of a 19 nucleotide tetracycline operator (tetO) sequence, and is recognized by the tetracycline...reduced gene expression. This idea of a hybrid transactivator was initially used with the lac system. Tetracycline...gene of interest with Strep-Tag and Tet-On 3G transactivator, creating an auto-regulated Tet-On 3G System... Lentiviral reverse tetracycline-controlled transactivator 3 (rtTA3) expression vector, CMV promoter, ...

...RNA-guided transcriptional activator system with two components, the dCas9 activator protein and the single...with 10. dCas9 activators and sgRNAs can be separately transfected (pmax dCas9 activators [48223~48227]...enhancers of genes of interest. Different flavors of activators were constructed, with VP48 containing 3x minimal...single dual-expression vector [48236~48240]. dCas9 activator ORFs (with Stop codon) are also available as Gateway...genes by CRISPR-on, an RNA-guided transcriptional activator system. Cheng AW, Wang H, Yang H, Shi L, Katz ...be ordered via the links below: Table 1. dCas9 Activators sgRNA Dual Expression ID Plasmid 48236 pAC2-dual-dCas9VP48... from separate promoters. Table 2. pmax dCas9 Activator Expression Plasmids ID Plasmid 48223 pAC91-pmax-dCas9VP64...

... Frederick National Laboratory for Cancer Research . Frederick National Laboratory for Cancer Research...RASA3 RAS p21 protein activator RASAL RASAL1 RASAL2 RASAL3 RAS protein activator like RASGRF RASGRF1 RASGRF2...Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory Subunits PIK3R1 PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIK3R6...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl cis/trans... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide... RPS6KB2 Ribosomal protein S6 kinase B1 RPTOR Regulatory associated protein of MTOR, complex 1 SAV1 Salvador...

... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...

...nEF CAG E2 regulatory element Tag Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity ...83896 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, rg* Fishell 83897...83897 pAAV-hDlx-GqDREADD-dTomato-Fishell-4 hM3D(Gq) - Activation NLS-dTomato none 1, 9, rg* Fishell 50472...Deisseroth 135635 pAAV-S5E2-Gq-P2A-dTomato hM3D(Gq) - Activation dTomato (physically separate) none 1, 9,...

...effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have been ...zinc finger nucleases (ZFNs) or transcription-activator-like effector nucleases (TALENs) required scientists...fusing dCas9 to transcriptional repressors or activators and targeting promoter regions. You might sometimes...mice and human cells. The simplest dCas9-based activators and repressors consist of dCas9 fused directly...directly to a single transcriptional activator (e.g. VP64) or repressor (e.g. KRAB; Figure 9A). Other examples...co-expression of epitope-tagged dCas9 and antibody-activator effector proteins; long-term imaging of proteins...instead of a two-component system (Figure 9C) SAM activators - co-expression of dCas9-VP64 with a modified...

...mutations of these regulatory elements on gene expression. Empty backbones for inserting regulatory elements before...are commonly used to investigate the effect of regulatory elements, such as promoters, enhancers and untranslated...Optimized STARR-seq ( S elf- T ranscribing A ctive R egulatory R egion) plasmids : Genome-wide screening of enhancer...cloning to test for the presence of transcriptional regulatory region in specific cell types. Used to identify...backbone plasmids into which you can clone your regulatory element or gene of interest into to create a ...Lentiviral expression of firefly luciferase and dTomato. A gene of interest can also be inserted into the...Reporter Constructs Already know what gene or regulatory element that you need a luciferase reporter for...

...Fibroblasts Hepatocytes Retroviral Mouse Direct conversion of mouse fibroblasts to hepatocyte-like cells.... 2016 Mar 7;7:10869. Hu CRISPRa Human CRISPR activator system for reprogramming human cells to pluripotency...genes Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski ...generation OCT4 and SOX2 Work as Transcriptional Activators in Reprogramming Human Fibroblasts. Cell Rep....2013 Apr 13;60C:97-106. Gearhart Fibroblasts Hematopoietic Progenitor Cells Lentiviral Mouse Direct reprogramming...reprogramming of murine fibroblasts to hematopoietic progenitor cells. Cell Rep. 2014 Dec 11;9(5):1871-...1871-84. Lacaud Fibroblasts Hematopoietic Progenitor Cells Lentiviral Human Cooperative Transcription Factor...

...-nls-dTomato EF1a GCaMP6f dTomato Cre dependent rg* Ting 51085 AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f...Rose 51082 AAV-EF1a-DIO-GCaMP6s-P2A-nls-dTomato EF1a GCaMP6s dTomato Cre dependent 1 Ting 105714 pAAV-Ef1a-fDIO-GCaMP6s...Larsen 51084 AAV-hSyn1-GCaMP6s-P2A-nls-dTomato Syn GCaMP6s dTomato Constitutive 1, rg* Ting 68717 pAAV-CAG-Flex-mRuby2...CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2 regulatory element Activity Cre-dependent Flp-dependent ... GCaMP6f dTomato Constitutive 1, rg* Ting 52924 pZac2.1 gfaABC1D-lck-GCaMP6f GfaABC1D GCaMP6f none Constitutive...

...Goldstein Nematode: gRNA design and cloning Cas9-sgRNA construct PDF 355.3 KB Goldstein Nematode: Injection... dCas9 activators sgRNA dual expression: pAC2 , pAC152 , pAC153 , pAC154 ; pmax dCas9 activator expression...cow, dog, pig, Thale cress, rice (Oryza sativa), tomato, corn, monkey (macaca mulatta). Cas-Designer searches...rice fish, mouse, silk worm, stickleback, tobacco, tomato, frog ( X. laevis and X. tropicalis ), and zebrafish...pAC91 , pAC92 , pAC93 , pAC94 , pAC95 ; dCas9 activator gateway donors: pAC84 , pAC1 , pAC147 , pAC148... ; gateway destination: pAC90 PDF 1.0 MB Katic Nematode: Cas9 and gRNA use Cas9 (pIK86) ; gRNA empty backbone...

...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell... working with the RSRT along with individual laboratories to assemble a Rett Syndrome plasmid resource...The MECP2 protein is a global transcriptional regulator of thousands of genes and studies have suggested...contains a Nuclear receptor Co-Repressor 1/Silencing Mediator of Retinoic acid and Thyroid hormone receptor ...contact information by following the link to their laboratory website. Mouse Line Mutation (DNA) Background...contact information by following the link to their laboratory website. Cell Line Mutation (DNA) Mutation (protein...prenatal LMD microarray data, ISH image data, and anatomic reference atlases of prenatal and adult human ...

...dCas9) can be fused to a transactivator and used as a transcriptional activator . ID Name Insert Antibiotic...dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 lenti dCAS-VP64_Blast ...Hygromycin lenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker...Celltag library contains 19973 barcodes to combinatorially index cells for single-cell analysis of clonal... Celltag library contains 4934 barcodes to combinatorially index cells for single-cell analysis of clonal... Celltag library contains 5737 barcodes to combinatorially index cells for single-cell analysis of clonal...

.... enhanced signaling of mTOR, a key metabolic regulator, correlates with poor prognosis in many cancers...arget o f r apamycin (mTOR) is a key metabolic regulator controlling cell growth and proliferation... caused by inactivating mutations in negative regulators of mTORC1. The hyperactivation of mTORC1 in cancer...Ras-related GTP binding Raptor Also known as RPTOR; Regulatory associated protein of MTOR, complex 1 Rheb Ras...Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory Subunits PIK3R1 PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIK3R6...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PKC PKC alpha PKC beta PKC...

...Constructs Kits and Collections Other Resources The nematode Caenorhabditis elegans ( C. elegans or “the worm... approach has also been developed by the Fire laboratory and described in Efficient Marker-Free Recovery...contains 29 plasmids used to generate transgenic nematodes, including C. elegans and C. briggsae. Other related...A database featuring behavioral and structural anatomoy of C. elegans. WormBase - A consortium of biologists...genomics and biology of C. elegans and related nematodes. WormBook - A comprehensive, open-access collection...related to the biology of C. elegans and other nematodes. Wormbuilder - Describes methods to engineer the...

...Reagents from the Keith Joung laboratory for engineering TAL effectors, including designed TALENs, and..., Nat Biotechnol. 2011 ) TALE transcriptional activators in human cells ( Maeder et al., Nat Methods 2013...dimeric TALEN and monomeric TALE transcriptional activator target sites and to simplify the construction ...interest for potential TALEN or TALE transcriptional activator target sites and then generates individual user-friendly...REAL, REAL-Fast and FLASH TALE Transcriptional Activator Expression Vectors for REAL, REAL-Fast and FLASH...

...fluorophores, excitatory and inhibitory opsins , genetically-encoded calcium indicators, and rabies targeting...INTRSECT (intronic recombinase sites enabling combinatorial targeting) is a synthetic molecular targeting...doubly-specified combination of genetic and/or anatomical-defined parameters, by placing two orthogonal...Fon-sRGECO Flp AND NOT Cre Dual recombinase-dependent: Excitatory Opsins Addgene ID Plasmid Logic Sites and Mutations...window) Cummings KA, Clem RL. 2020. Prefrontal somatostatin interneurons encode fear memory. Nat Neurosci...

...and synthetic regulatory elements, including promoters, terminators, repressors, activators, and more. Also... Lab Repressors , Terminators , Light Signaling , Sigma Factors , Resource Allocator and Orthogonal Switches...

..., which disrupt its interaction with negative regulators, increase its stability and DNA binding activity...activity, and allow it to bind transcriptional co-activators and modulate transcription. The list of p53 transcriptional...proto-oncogene, E3 ubiquitin protein ligase MDMX p53 regulator; also known as MDM4 Noxa Phorbol-12-myristate-...peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 PERP TP53 apoptosis...binding component 3 Reprimo TP53 dependent G2 arrest mediator candidate Scotin Shisa family member 5 Sestrins...

... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission...

...from the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution...Shivdasani Dana-Farber Cancer Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors...Tumors Qiao Zhou Harvard University Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. Want more information ...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...

...Expresses dCAS9-VP64 activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with...screening library CRISPR/Cas9 Synergistic Activation Mediator (SAM) is an engineered protein complex for the...: lentiviral vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker...JS, Konermann S, Trevino AE, Scott DA, Inoue A, Matoba S, Zhang Y, Zhang F. Cell . 2013 Sep 12;154(6):...

...3rd 10 187,535 Advanced Catalogue of Epigenetic Regulators (ACER) 226117 Knockout Human Lu 3rd 10 8,205 ...Knockout Mouse Tolar 3rd ~4 78,637 Mouse Chromatin Regulator Library 200011 Knockout Mouse Griffin, Manguso...4 17,032 arrays Mouse Cardiac Transcriptional Regulators CRISPR Knockout Library 138015 Knockout Mouse...CRASP-Seq Gene KO Library 232069 Knockout Human Gonatopoulos-Pournatzis 3rd Varies 95,893 CRASP-Seq BE Tiling...Tiling Library 232070 Base Editing Human Gonatopoulos-Pournatzis 3rd Varies 8,594 No available items found...

...HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF14 hepatocyte nuclear factor 4, alpha NR0B1 Plasmids NR0B1,....5, NR1C1, PPAR, PPARalpha, hPPAR peroxisome proliferator-activated receptor alpha PPARD Plasmids PPARD..., NR1C2, NUC1, NUCI, NUCII, PPARB peroxisome proliferator-activated receptor delta PPARG Plasmids PPARG... NR1C3, PPARG1, PPARG2, PPARgamma peroxisome proliferator-activated receptor gamma RARA Plasmids RARA,...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...

... Institute Katherine Matho Cold Spring Harbor Laboratory Gowan Tervo Janelia Research Campus Sarada Viswanathan...Regulation Ben Deverman 2:00 PM Cre-DOG and Combinatorial Strategies Connie Cepko 2:45 PM Break 3:00 PM...In vivo data: Retrograde hSyn1-GCaMP6f-P2A-nls-dTomato Detailed protocol: AAV Production in HEK293 Cells...Institute Katherine Matho, Cold Spring Harbor Laboratory Gowan Tervo and Sarada Viswanathan, Janelia Research...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...

...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest....Catalytically dead dCas9 fused to a transcriptional activator peptide can increase transcription of a specific...separate gRNA expression plasmid to target the dCas9-activator to your specific locus. ID Plasmid Gene/Insert...

...platforms to reliably detect nucleic acids at the atomolar level. For more information read Addgene's Blog...and open-access SARS-CoV-2 detection assay for laboratory and home testing. Kellner, et al. bioRxiv 2020.06.23.166397...Cathepsin L Functionally Cleaves the Severe Acute Respiratory Syndrome Coronavirus Class I Fusion Protein Upstream...TMPRSS2 augments entry driven by the severe acute respiratory syndrome coronavirus spike protein. . PCP4 - ...

...Examples Include: promoters and terminators repressors and activators logic gates Networks and Gene Regulation...includes both naturally ocurring and synthetic regulatory elements, pre-assembled genetic circuits, and...

...CRISPR CRISPR-on: an RNA-guided transcriptional activator system - Jaenisch Locus-specific ChIP technologies...Collection Screening Multiplexed Overexpression of Regulatory Factors (MORF) Collection Synthetic Biology Voigt... Repressor Plasmids Sigma (σ) Factor Plasmids Terminator Plasmids Viral Vectors pLEG/pREG Modular Viral...

...support educators interested in integrating MDH-related research into their teaching laboratories. They ...professional development, membership to a local hub of educators teaching MDH CUREs, and opportunities to mentor...

...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other...

...ARF family plasmids. ARF family members include regulatory GTPases, GEFs, and GAPs....Plasmids The ARF (ADP-ribosylation factor) family of regulatory GTPases have long been characterized as members...26893300 ). Though best known for their roles as regulators of membrane traffic, they also play critical ...