... lentiviral vector that contains a scrambled shRNA. This scrambled shRNA is used as a negative control...envelope expressing plasmid pMD2.G. Find pMDLg/pRPE. scramble shRNA - This plasmid from David Sabatini’s lab...control for mammalian RNAi experiments.  Find the scrambled shRNA vector. pLKO.1 - TRC cloning vector - This...

...expression. To test their hypothesis, they randomly scrambled one pair of lox sites and either used the same...transgene (homologous pairs) or used different scrambled sequences to flank the transgenes (non-homologous...amplification. On the left homologous pairs of scrambled cre-recombinase sites lead to greater frequency...leaky expression. On the right non-homologous scrambled recombination sights lead to reduced reversion...

...signal (~250-fold enrichment) when compared to a scrambled RNA motif control). BioID2 had no detectable signal...experiments RaPID negative controls include both scrambled RNA motifs and cells transfected with BirA* protein...

...David Root 1864 pLKO.1 ‐ scrambled shRNA Negative control vector containing scrambled shRNA David Sabatini...

...including beta-catenin reporter M50 Super 8x TOPFlash, scramble shRNA for use as a negative control, and empty...

...poster board well ahead of time ensures you aren’t scrambling to tack up your poster seconds before the session...

...Jennifer and I spent about an hour that morning scrambling. Everything we had set up involved multiple people...

...very relieved not to be going through the urgent scramble of their peer institutions. The issues facing ...

...non-hairpin insert. pLKO.1 – scramble shRNA Negative control vector containing scrambled shRNA. psPAX2 Packaging...

...AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes 23360965 Marraffini scramble synthetic AACCCCTGATTGTATCCGCA 62285 interfere...