...showed the expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed...based on the ability to correctly assemble a lacI/lacZ cassette (designed by NEB for use in optimization...coding sequence for beta-galactosidase in the lacI/lacZ cassette. Additional confirmation of accurate assemblies...blue phenotype. Indeed, this was seen in all lacI/ lacZ assembly test systems; no blue colonies were obtained...from 1-, 12- and 24-fragment assemblies of the lacI/lacZ cassette, and illustrates how the volume of the ...fidelity and assembly efficiency Five fragment lacI/lacZ cassette assembly was easily achievable with high...both the 12- and 24-fragment versions of the lacI/lacZ cassette were designed and synthesized. In conjunction...

...the blue-white screen, which relies on the lacZ gene. lacZ encodes the enzyme 𝛽-galactosidase which can...on vectors where the gene of interest is inserted into the middle of the lacZ gene, thus disrupting 𝛽-... for blue-white screening at Addgene! Some bacterial strains contain lacZ in their genome, and scientists...where only cells that have gained or lost a specific gene survive (ex: antibiotic resistance marker). In a...scientists have found that when a portion of the gene is deleted, it creates a non-functional 𝛽-galactosidase...mentioned above. In molecular biology, cloning a gene into your plasmid is often a numbers game. By using...troubleshooting Sanger sequencing results. At Addgene, we now use next-generation sequencing during our QC process....

...specific genes are signified with a minus sign (-) as is typically standard; just having the gene listed... of the more common genetic changes found in E. coli strains. Table 1: Common gene mutations found in ...expressing the ccdB gene (important in Gateway cloning). F-mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1...lacIq ∆(lacZ)M15 zzf::Tn10 (TetR) ∆(ara-leu) 7697 araD139 fhuA ∆lacX74 galK16 galE15 e14-  Φ80dlacZ∆M15 recA1...carefully selected the optimal promoter for your gene of interest, painstakingly cloned into the perfect...backbone, made sure to add the right tags to your gene, and may have even put a fluorescent protein downstream...in E.coli strains Gene(s) Description Functional Consequence dam DNA adenine methylase mutation (GATC...

...that deleting a section from the lacZ gene (a mutation called lacZΔM15) creates a non-functional β-galactosidase...well-characterized bacterial lac operon contains a gene called lacZ that encodes for the enzyme β-galactosidase...the plasmid containing the lethal gene. An example is the ccdB gene system commonly used in Gateway® Cloning...are rescued by genes supplied on the transformed plasmid. Such plasmids may contain genes that allow for...auxotrophic cell lines), or genes which rescue a lethal phenotype. Resources on the Addgene Blog Read Our Post...other methods. Positive selection vectors encode a gene which, when expressed, is lethal to the cell. Cloning...fragments are inserted into an MCS in the center of this gene, disrupting the lethality. This is similar to α-...

...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181...

...applications used to study gene function. From making transgenic animals, gene targeting and genome modifications...These vectors allow you to test the function of Your Gene Of Interest (YGOI) in a controlled environment under...design. You can create a new strain with a disrupted gene by transforming wild-type yeast with an integrating...involve using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following the expression...modifications to reporter vectors (e.g. pBV-Luc) and gene silencing (e.g. pLKO.1 - TRC cloning vector). Check... More Plasmid Resources from Addgene: Plasmids 101 blog series Addgene's Molecular Cloning Guide & Other... is which vector will best suit your needs? At Addgene, we have a vast collection of empty backbones that...

...for the gene on the toehold switch to be expressed. In this case, the gene encodes the LacZ𝛼 protein....protein. Once expressed, LacZ𝛼 complexes with LacZ𝜔 and forms an active LacZ tetramer.  This tetramer cleaves...interfere with other genetic pathways making it difficult to link a phenotype to the gene being targeted via...need for mutant genetic backgrounds. The standard RNAi vector, L4440, places a target gene between two inverted..., highly efficient RNAi construct for C. elegans gene knockdown Article contributed by Alyssa Cecchetelli...extensively used in C. elegans research to study gene function. RNAi is commonly achieved by feeding E... from each promoter progresses past the specific gene producing long unspecific RNA fragments that are...

...Plasmids for endogenous gene tagging in human cells Resources on Addgene.org Browse all CRISPR plasmids...expressing a control -- for example, an FKBP12F36V-tagged LACZ) with dTAG molecules in your biological assay of...endogenous ENL was inactivated using CRISPR/Cas9 gene-editing. Featured molecules: dTAG-7 and dTAG-13 ...endogenous MELK was inactivated using CRISPR/Cas9 gene-editing. Featured molecules: dTAG-7, dTAG-13, and...Figure 1). Plasmids: We generated a series of plasmids that are available from Addgene. These plasmids enable...47 Additional Resources on the Addgene Blog Easi-CRISPR: Generating Knock-In and Conditional Mouse Models.... To overcome this limitation, we created a generalizable tag-based strategy, which we refer to as the...

...the neuronal-specific gene NeuN. As a control they designed an sgRNA targeting LacZ, which is not present...sgRNA targeted to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid... information, please visit the Addgene SAM library page . Targeted gene activation using SAM There are...available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424 were designed...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...

...activation sequence (UAS) of its target gene, in this case a reporter gene (e.g. luciferase or GFP), regardless...promoter of the reporter gene to activate expression (Figure 2c). The reporter gene then allows detection...Gal4 activator, bacterial LexA DBD and the lacZ reporter gene (3, 4), there are now many variations, including...Shapira S.K., Chou J. Beta-galactosidase gene fusions for analyzing gene expression in Escherichia coli and ...hybrid system (also called the interaction trap), genes encoding proteins of interest(POI’s) are fused to... in a yeast strain that also contains a reporter gene cloned downstream of a promoter containing the target... the “bait”, Figure 2b) cannot activate reporter gene expression on its own, but, if the two POI’s interact...

...the ccdB gene is replaced by the gene of interest. As a result, cells that retain the ccdB gene die off...tool. The plasmid pKSCTMF contains the mazF gene and a gene for Zeocin resistance (Figure 2). This MazF-ZeoR...antisense RNA regulates hok gene expression indirectly through the overlapping mok gene." Journal of molecular...associated genes. These systems better ensure that plasmids are passed down through generations (Figure ...application of CcdB is GatewayTM cloning, where the ccdB gene serves as a counterselectable marker in the destination...death. The team used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed...toxin-antitoxin system to construct a stable synthetic gene circuit that can be used over prolonged periods....

...remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter pCDH-EF1s 72484 Express gene of interest from ...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...Kazuhiro Oka from the Baylor College of Medicine Gene Vector Core Viral...Lentiviral Vectors Baylor College of Medicine Gene Vector Core Lentiviral and Adenoviral Vectors You may...

...genome; does not restrict methylated DNA fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73::miniTn10--TetS...IPTG. T7 RNAP is then available to transcribe the gene of interest from a T7 promoter on the plasmid. Many...cytosine within a particular sequence. Browse Addgene's curated list of Bacterial Expression Systems Table...DE3) F- ompT lon hsdSB (rB- mB-) gal dcm (DE3) General protein expression BL21 (DE3) pLysS* Chloramphenicol...ompT lon hsdSB (rB- mB-) gal dcm rne131 (DE3) General expression; not recommended for toxic proteins ...lon hsdSB (rB- mB-) gal dcm araB::T7RNAP-tetA General protein expression  BLR (DE3) Tetracycline RecA-deficient...-TetS)2 [dcm] R(zgb-210::Tn10--TetS) General protein expression  m15 pREP4*, ** Kanamycin (pREP4) Cis-repression...

...perspective, sometimes it’s best to delete genes from or introduce new genes and mutations to the bacterial genome... in control of gene expression so be sure to try a few different systems with your gene/protein of interest...Plasmids containing easily measurable reporter genes (eg. LacZ or Fluorescent Proteins ) under the control...Engineering Although overexpressing or knocking down a gene can tell you much about its function and/or alter...you're studying the basic biology of a bacterial gene or redirecting metabolic pathways to produce a therapeutic...Expression of customizable guide RNA (gRNA) for bacterial gene disruption or knockdown. For a more comprehensive...Various Plasmids Tn7 Transposition Nancy Craig A gene of interest cloned into one of these plasmids can...

...approaches increase the size of the gene delivered by splitting the gene into two pieces: part A and part...packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. ...how do you fit a big gene into a tiny vector like AAV? By breaking the transgene into smaller pieces. ...acceptor sequence, the 3’ half of the transgene. The full length gene is reconstituted by either the overlapping...Expressing Transgenes That Exceed the Packaging Capacity of Adeno-Associated Virus Capsids. Human Gene Therapy...Chamberlain JS (2011) Gene Therapy of mdx Mice With Large Truncated Dystrophins Generated by Recombination ...retinal gene therapy Learn about the parts of an AAV transfer plasmid Resources on Addgene.org: Check...

... In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13/...Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG...reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) ...' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG...resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, reverse ...ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward CGCAAATGGGCGGTAGGCGTG...

...temperature. ID Name 13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4...article in which they were created, and include Addgene in the Materials and Methods of your future publications... this publication was a gift from Keith Joung (Addgene kit # 1000000013)" For your Reference section: ...

...briggsae , etc.) gene or sequence: ID Plasmid Gene/Insert PI Don’t see your gene listed? Know of some great...can knock down genes by feeding worms bacteria expressing dsRNA or use CRISPR/Cas9 gene editing to easily... used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert PI Plasmids Expressing...which diminishes epigenetic silencing in the germline. A "FLP-Out" system for controlled gene expression in...Expressing Worm Genes/Inserts The table below lists plasmids that contain a worm ( C. elegans, C. briggsae...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...

... order to generate TALORs (TAL Orthongal Repressors) that can be used to custom repress gene expression... successfully been employed for deletion mutagenesis and gene targeting in human and mouse pluripotent...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii...editing was also shown to alter regulation of nearby gene expression. The vectors listed below have the EF1α...kits and accessory plasmids available from Addgene for generating your own specific TALE plasmids. Genome... TALEN Plasmids and Kits You may also like... Addgene's Genome Engineering Guide CRISPR Plasmids Zinc ...amino acid repeats in the TAL effectors. View Addgene's TALEN Guide. These collections and accompanying...

..., 5, 8, 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV....control AAV that express fluorescent proteins under general promoters. These AAV can be used to compare the...