...fly (Drosophila melanogaster) Another popular model organism is Drosophila melanogaster, or as it is more...Nichols. "Human disease models in Drosophila melanogaster and the role of the fly in therapeutic drug ...

...cytochrome P450 genes discovered in Drosophila melanogaster (Gilbert, 2004). Mutations in these genes are...mediate steroid hormone biosynthesis in Drosophila melanogaster." Molecular and cellular endocrinology 215.1...

... organs located deep in the body, like the gastrointestinal tract. Require Administration of Substrate...coli aided in ultrasound imaging of the mouse gastrointestinal tract. The E. coli strain Nissle 197 (ECN)...

...using them grow. So, think beyond Drosophila melanogaster or Saccharomyces cerevisiae (both fine research...This is actually rare in the animal kingdom. Gasterosteus aculeates (Dan Bolnick) A paper on stickleback...

...Flybow adapts Brainbow 2.0 for use in Drosophila melanogaster and is under the control of Flp recombinase....labeling for neural circuit analysis in Drosophila melanogaster." Nature methods 8.3 (2011): 260. PubMed PMID...

...organs in whole animal models like Drosophila melanogaster, obtaining enough material for a ChIP-seq experiment...

... ubiquitous genome engineering in Drosophila melanogaster. Bullock 62208 pnos-Cas9-nos Expresses Cas9 ... restricted genome engineering in Drosophila melanogaster. Bullock 62211 pAct-Fok1:dCas9 Expresses Fok1...specificity genome engineering in Drosophila melanogaster. Bullock 62210 pnos-Fok1:dCas9-nos Expresses...specificity genome engineering in Drosophila melanogaster. Bullock...

..., X. laevis (frog), D. rerio (zebrafish), D. melanogaster (fly), C. elegans (nematode), S. cerevisiae ...

...targeting Cas system that can be used in Drosophila melanogaster. Get the plasmids at Addgene The Cas Hybrid...

...Toolbox for Genome Editing in Cultured Drosophila melanogaster Cells.” G3 (Bethesda) 6(6) (2016):1777-85. PubMed...

...Replacement by Compound Autosomes in Drosophila melanogaster. Genetics 74, 461–475 (1973). PubMed. More ...

...Journal of Number Theory (1,519 views), and Gastroenterology (1,046 views) rounded out the top four average...

...labeling for neural circuit analysis in Drosophila melanogaster. Hadjieconomou D, Rotkopf S, Alexandre C, Bell...

...academic labs, targeting mouse, human, Drosophila melanogaster, and T. gondii are available through www.addgene.org...

...MGC125983, MGC125984 GALR3 galanin receptor 3 - GAST gastrin GAS GCG glucagon GLP1, GLP2, GRPP GCGR glucagon...secretagogue receptor - GIP gastric inhibitory polypeptide - GIPR gastric inhibitory polypeptide receptor...HSCR, HSCR2 EGF epidermal growth factor (beta-urogastrone) HOMG4, URG EGFR epidermal growth factor receptor...receptor MGC126722 GKN1 gastrokine 1 AMP18, BRICD1, CA11, FOV, MGC70354, foveolin GLP1R glucagon-like peptide... GRN granulin GEP, GP88, PCDGF, PEPI, PGRN GRP gastrin-releasing peptide BN, GRP-10, preproGRP, proGRP...

...colorectal cancer. Zenonos K, Kyprianou K. World J Gastrointest Oncol. 2013 May 15; 5(5): 97–101. doi: 10.4251...

...germline mutations in Bombyx mori and Drosophila melanogaster . Zhang Lab TALE Toolbox 49622 - 49647 24 plasmids...

...Neelamegham 3rd 10 3,637 Oxford Fly 64750 Knockout D. melanogaster Liu N/A 3 40,279 Pan-Druggable Cancer Library...

...61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186...