Skip to main content
Addgene
Showing: 1 - 20 of 23 results

  1. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...irreversible PA-FP reported was PA-GFP. PA-GFP was derived from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating...mutation in PA-GFP generates a chromophore population that is more neutral, causing PA-GFP to display ...imaging models perfer the PA-RFPs over PA-GFP. Another class of irreversible PA-FPs are the photoconvertible...blue light (1). Similar to PA-GFP, scientists later developed red fluorescent PA-FPs by performing several...example, by engineering PA-GFP tagged to a mitochondrial matrix protein (mito-PAGFP) the Youle Lab was able...from the neutral to the anionic form, which allows PA-GFP to exhibit up to a 100-fold increase in fluorescence...Fluorescence) Brightness Excitation/ Emission (nm) PA-GFP Monomer UV-Violet Dark/ Green ~200 Medium 504/ ...

  2. New Optogenetic Tools for Cytoskeleton and Membrane Control

    Type
    Blog Post
    ...magenta) and PA probe GFP-PASS (green). After 30 minutes of blue light illumination, substantial PA accumulates...activity can be monitored by phosphatidic acid probe GFP-PASS. B) Time series of HEK 293T cells expressing...predominant membrane lipid, to phosphatidic acid (PA) or it can swap phosphatidylchonine’s choline head...    Figure 4: SuperPLD hydrolyzes membrane PC to PA. A) OptoPLD is recruited to plasma membrane or lysosomes...accumulates in the plasma membranes, indicated by the PA probe colocalizing with SuperPLDx30. Scale bar 10 ...

  3. Split Fluorescent Proteins for Studying Protein-Protein Interactions

    Type
    Blog Post
    ...Chang-Deng Hu Green sfGFP Split super-folder GFP, our most-requested GFP(1-10) and GFP(11) Versatile protein...Commun. 2016 Bo Huang spGFP Split superpositive GFP Split-superpositive GFP reassembly is a fast, efficient...base FP (for example, EBFP2(1-10) can be used with GFP(11)). Some of the articles linked below only provide...Blue EBFP2 EBFP2(1-10) and Capri(1-10) for use with GFP(11) Multiplexed labeling of cellular proteins with... Kamiyama Cerulean Cerulean(1-10) for use with GFP(11) Multiplexed labeling of cellular proteins with...background signal (especially for some older split-GFP constructs or certain cell environments). Also consider... Huang Near-Infrared iRFP iSplit, comprised of PAS and GAF domains of iRFP713. Requires presence of ...

  4. Which Fluorescent Protein Should I Use?

    Type
    Blog Post
    ... of GFP, it's variants, and their relevant mutations, check out Marcy's post from last week on GFP. Additionally... are PA-GFP, Dendra2, and the mEOS proteins. Some proteins are reversibly switchable (e.g. rsEGFP, Dreiklang... a few hours. For example, superfolder GFP (sfGFP) and mNeonGFP can fold in <10min at 37°C, mCherry takes...affected by the temperature. For instance, enhanced GFP (EGFP) was optimized for 37°C, and is therefore most... the discovery of the Green Fluorescent Protein (GFP), a protein from the jellyfish Aequorea Victoria....below (or emission wavelenght range).  By mutating GFP, the variants blue FP (BFP), cyan FP (CFP), and yellow...be found at Addgene. Split FPs – some FPs (e.g. GFP, Venus) can be split into two halves, which are non-fluorescent...

  6. Lighting Up Cell Signaling with Photoswitchable Kinases

    Type
    Blog Post
    ...Expression with Cre-lox Control Protein Activity with GFP Resources at Addgene.org Find KTR reporter plasmids...photoswitchable Dronpa (dron= a ninja term for vanishing, and pa= photoactivation) domains on either side of the active...

  7. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...22222-AAV1 AAV-FLEX-Arch-GFP Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Ed Boyden AV...pAAV-CamKII-ArchT-GFP (PV2527) Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Ed Boyden AV-5-PV3447...pAAV-hsyn-Jaws-KGC-GFP-ER2 Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Ed Boyden AV-9-...22222-AAV9 AAV-FLEX-Arch-GFP Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Ed Boyden AV...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger...AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT Ed...

  8. Hot Plasmids Spring 2024

    Type
    Blog Post
    ...Figure 5: A) Representative confocal images showing GFP expression from ssAAV5s with hIBA1 or hIBA1a promoters...Quantifications showing high microglia specificity of GFP expression for the indicated ssAAV5s. C) Quantifications...SDS, splice donor site; SAS, splice acceptor site; pA, polyadenylation signal. Image reused from Riedmayr...

  9. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression PA-sfGFP 485 511 Prone to dimerization PA-sfGFP-N1 - Mammalian Expression PA-sfGFP-C1 - Mammalian...Mammalian Expression PA-GFP 504 517 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian...then scientists have engineered numerous GFP-variants and non-GFP proteins that result in a diverse set ...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab Plasmids...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...

  10. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs mediate... B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F (2015) In vivo genome editing using Staphylococcus...

  11. Mammalian RNAi Tools

    Type
    Collection
    ...pMKO.1 puro GFP shRNA Negative control vector for pMKO.1 puro; Contains shRNA against GFP William Hahn...Hahn 10676 pMKO.1 GFP Derivative of pMKO.1 puro with GFP instead of puromycin resistance gene William Hahn...Ventura A, Meissner A, Dillon CP, McManus M, Sharp PA, Van Parijs L, Jaenisch R, Jacks T. PNAS. 2004. Jul...Yu EY, An DS, Sabatini DM, Chen IS, Hahn WC, Sharp PA, Weinberg RA, Novina CD. RNA. 2003. 9(4):493-501....Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included in the vector to monitor...Plasmid Description PI 11578 pSico Cre addition causes EGFP to be recombined out of the construct, activating...Tyler Jacks 11579 pSicoR Cre addition causes both EGFP and shRNA to be recombined out of the construct,...

  12. Cre-lox system

    Type
    Collection
    ...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV... CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre...CAG Retroviral Gage 49056 AAV-GFP/Cre Cre-GFP fusion CMV AAV Gage 49111 pEMS1980 iCre with MCS for inserting...

  13. Sequencing Primers

    Type
    Guide
    ...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region...of tetracycline resistance gene, reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...

  14. Biosensor AAV Preps

    Type
    Collection
    ...pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...GCaMP6f 50943 pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA Syn GCaMP6f mRuby2 Constitutive 1 Bonhoeffer , Huebener...Khakh 68719 pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6f-WPRE-pA CAG GCaMP6f mRuby2 Cre dependent 1 Bonhoeffer , Huebener...GCaMP6s 50942 pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Syn GCaMP6s mRuby2 Constitutive 1 Bonhoeffer , Huebener...Ting 68717 pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA CAG GCaMP6s mRuby2 Cre dependent 1 Bonhoeffer , Huebener...68720 pAAV-hSyn1-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA Syn GCaMP6s mRuby2 Cre dependent 1 Bonhoeffer , Huebener...

  15. Zhang Lab CRISPR Page

    Type
    Collection
    ...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ... B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang F. Nature . 2015 Apr 9;520(7546):186-91. doi...9, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell . 2014 Oct 9;159(2):440-55. doi: 10.1016... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...

  16. Optogenetics AAV Preps

    Type
    Collection
    ...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Cre dependent 9 Histed 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...EF1a/nEF Synapsin E2 regulatory element Fluorophore GFP Red-wavelength fluorescent protein Yellow-wavelength...

  17. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A     ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...monoclonal antibodies against them, fused them to GFP, and compared them to popularly used epitopes tags...

  18. Arf GTPase Family

    Type
    Collection
    ...Cherfils J, Dacks JB, Lambright DG, Lee FS, Randazzo PA, Santy LC, Schürmann A, Wilhelmi I, Yohe ME, Kahn...Arap2 116984 1704 GAP Arap3 64411 1544 Mammalian (pEGFP-C2) GAP Acap1 9744 740 Mammalian (pFLAG-CMV2) GAP... 9267 398 Gateway GEF Cyth2 9266 400 Mammalian (pEGFP-C1), Gateway GEF Cyth3 9265 399 Gateway GEF Cyth4...

  19. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...74302 pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA Zebrafish Expression   Human kinase domain constructs...

  20. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Cerulean Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes Elverlov-Jakobsen...pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro...pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert pSECC 60820...tagRFP657 Ebert pL-CRISPR.SFFV.GFP 57827 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO5.sgRNA.EFS.tRFP...
Showing: 1 - 20 of 23 results