...By Mike Lacy Several types of drugs target the ubiquitin E3 ligase cereblon (CRBN), including popular new...with the multiple myeloma drug mezigdomide and ubiquitination substrate Ikaros (IKZF1ZF2) (B). Image adapted...structure-guided drug design and studies of protein ubiquitination and degradation.   Find the CRBNmidi plasmid...considerably faster, with expression levels comparable to GFP during early embryogenesis (Figure 3). mScarlet-I3...through the middle of each embryo are shown, comparing GFP, wrmScarlet (mScarlet), and the new mScarlet3 and... focal adhesion marker paxillin (visualized with GFP). Reprinted with permission from Zhong et al, 2024...shorter than many popular fluorescence markers like GFP (510 nm), allowing co-imaging. And because bioluminescent...

...sender” cells express GFP on the surface and “receiver” cells express an anti-GFP nanobody on the cell ...to track cell-cell interactions By Jennifer Tsang GFP-based Touching Nexus (G-baToN) is a new tool developed...cell surface. When the cells interact, GFP is transferred to the receiver cell, and the receiver cell turns...other fluorophore/antibody pairs. Because the anti-GFP nanobody cross-reacts with BFP, sender cells expressing...endogenous Skp1 and Cul3 proteins to form a SCF E3 ubiquitin ligase complex. In the presence of auxin, this...developed a chemogenetic system that brings Cas9 to ubiquitin ligase for degradation.      New from the viral...expression of cytoplasmic-tdTomato and Synaptophysin-GFP. Synapse targeting GCaMP6s from the Rylan Larsen ...

...expression mRNA Mammalian promoter from the human ubiquitin C gene Constitutive  As the name implies, this...General expression mRNA Plant promoter from maize ubiquitin gene Constitutive  Gives high expression in plants...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...

... from the default GFP (green) to RFP, CFP, or YFP fluorescence. In Brainbow 2.1, GFP is tagged with a ...and activate fluorescence of the downstream OFP, GFP, or RFP. Cells that express the construct but do ...generates cells that randomly express either nuclear GFP, membrane CFP, cytoplasmic YFP, or cytoplasmic RFP...YFP. After crossing onto a tamoxifen-inducible ubiquitin background, each cell in the mouse that expresses...incorporates the highly photostable fluorophores mOrange2, EGFP, and mKate2 (red) to solve the problematically low...

...afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical abbreviations...mouse brains expressing green fluorescent protein (GFP) (6).   The Dodt and Frank Bradke laboratories later...subpopulation of neurons are brightly labeled with GFP (e.g. Thy1-YFP-H mice).  However, we recently developed...

...protease protection. Thus far Plasmids 101 has covered GFP and its related fluorescent proteins, which are sometimes...crystallizing it or testing its function. Small ubiquitin-related modifier (SUMO) can help with folding ... I Use? Plasmids 101: Green Fluorescent Protein (GFP) Fluorescent Protein Guide Expression Vectors from...

...in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with a transcriptional...requirement for transmembrane proteins, a split ubiquitin system has been devised (8). References 1. Casadaban...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should also...C321.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter ...ΔClpS.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, ClpS inactivated, with Ubiquitin-UAG-sfGFP...Mammalian TAG Peter Schultz 50831 pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli various unnatural...or DiZHSeC Mammalian TAG P. Chen 92047 pCOTS-pyl-GFP(35TAG) PylRS M. mazei Cyanobacterial TAG Lital Alfonta...analogs Mammalian TAG Huiwang Ai 160041 pRaGE Pyl TAG GFP Y35TAG PylRS M. mazei Bacterial TAG Lital Alfonta...-sfGFP reporter George Church 174513 Syn61 No TCG, TCA, or TAG codons in all open reading frames Jason...

...48201 CAG-GFP-IRES-CRE Cre and GFP coexpression CAG Retroviral Gage 49054 CAG-GFP/cre Cre-GFP fusion CAG...116879 CAG-Cremyc-2A-GFP GFP and Cre CAG Mammalian Lu 117148 Hiv7CMV-Cremyc-2A-GFP GFP and Cre CMV Lentiviral...iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks 68544 AAV-Cre-GFP Cre CMV AAV Nestler...13770 pCALNL-GFP Cre dependent GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch...promoterless CRE-GFP fusion none Mammalian Sauer 11960 pBS537 tet-hCMV-GFPcre tet inducible Cre-GFP fusion tet-hCMV... CMV Lentiviral Fuchs 26646 pCAG-Cre-IRES2-GFP Cre and GFP coexpression CAG Mammalian Chenn 26647 pCAG-Cre...CAG Retroviral Gage 49056 AAV-GFP/Cre Cre-GFP fusion CMV AAV Gage 49111 pEMS1980 iCre with MCS for inserting...

..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...AID tag could be targeted for degredation via ubiquitination. The key feature of auxin-induced degredation...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008...autophagic flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an...

...check out our article: Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection. Cellular...regulate numerous cellular functions, including ubiquitinoylation, kinase signaling, integrin signaling, and...

...pMKO.1 puro GFP shRNA Negative control vector for pMKO.1 puro; Contains shRNA against GFP William Hahn...Hahn 10676 pMKO.1 GFP Derivative of pMKO.1 puro with GFP instead of puromycin resistance gene William Hahn...Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included in the vector to monitor...Plasmid Description PI 11578 pSico Cre addition causes EGFP to be recombined out of the construct, activating...Tyler Jacks 11579 pSicoR Cre addition causes both EGFP and shRNA to be recombined out of the construct,...11651 pLVUT-tTR-KRAB 2nd generation; Transgene (hUbiquitin promoter) ‐ OR ‐ shRNA (H1 promoter when subcloned...