...Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre....

... enriched relative to controls using Split-BioID-GFP and BioID run on six unrelated proteins. One caveat...

...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain GFP Additional Vocabulary...throughout virus production. During experiments, GFP can be used to sort cells infected with adenovirus...

...pMKO.1 puro GFP shRNA Negative control vector for pMKO.1 puro; Contains shRNA against GFP William Hahn...Hahn 10676 pMKO.1 GFP Derivative of pMKO.1 puro with GFP instead of puromycin resistance gene William Hahn...Expresses shRNA under the mouse U6 promoter; A CMV-EGFP reporter cassette is included in the vector to monitor...Plasmid Description PI 11578 pSico Cre addition causes EGFP to be recombined out of the construct, activating...Tyler Jacks 11579 pSicoR Cre addition causes both EGFP and shRNA to be recombined out of the construct,...

... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...

...contrast, the widely used green fluorescent protein (GFP) gives a bright green fluorescence when exposed to...eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple...

..., Myc and SV40 Nuclear Localization Signals, and GFP. B) Workflow to assess Cas9-PAGE editing with viral...

...select both over- and under-expressing clones. If GFP-encoding cDNA is co-transfected at a favorable ratio...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

...In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest ...

...which must be stabilized by monomeric superfolded GFP and averages only ~50% RNA knockdown. In initial ...

...check out our article: Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection. Cellular...

... a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate cleavage...

...used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed mutations,...

...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG). There...

...mutation can be introduced in a gene, while adding a GFP-tag (Figure 3). Achieving multiple modifications...

...Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your Fluorescent Protein...

...Mammalian Cells Learn about the Dangers of Using GFP for Protein Localization Resources on Addgene.org...

...Lindsey M. Costantini, and Erik L. Snapp. "Superfolder GFP is fluorescent in oxidizing environments when targeted...

...in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with a transcriptional...