...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free...

... for a researcher to come into contact with than GFP. Similarly, if the viral vector carries an shRNA ...

... enriched relative to controls using Split-BioID-GFP and BioID run on six unrelated proteins. One caveat...

...Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre....

...pAdTrack series contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest...vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain GFP Additional Vocabulary...throughout virus production. During experiments, GFP can be used to sort cells infected with adenovirus...

...select both over- and under-expressing clones. If GFP-encoding cDNA is co-transfected at a favorable ratio...

...contrast, the widely used green fluorescent protein (GFP) gives a bright green fluorescence when exposed to...eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple...

..., Myc and SV40 Nuclear Localization Signals, and GFP. B) Workflow to assess Cas9-PAGE editing with viral...

...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...CCATCTAATTCAACAAGAATTGGGACAAC (Ahmad lab) 5' end of GFP, reverse primer GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae...forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of EGFP, forward primer EGFP-N CGTCGCCGTCCAGCTCGACCAG...end of EGFP, reverse primer EXFP-R GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP...

... a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate cleavage...

...Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your Fluorescent Protein...

...Mammalian Cells Learn about the Dangers of Using GFP for Protein Localization Resources on Addgene.org...

...Lindsey M. Costantini, and Erik L. Snapp. "Superfolder GFP is fluorescent in oxidizing environments when targeted...

...in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with a transcriptional...

...used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed mutations,...

...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG). There...

...mutation can be introduced in a gene, while adding a GFP-tag (Figure 3). Achieving multiple modifications...