...George Church Cynthia Collins James Collins Tom Ellis Drew Endy Tobias Erb Susan Golden John Gray Jeff... Keasling Taek Soon Lee Joshua Leonard Han Lim Wendell Lim Timothy Lu Michel Maharbiz Thorsten Mascher...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains... Circuit Transfer C. Collins Lab Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter...

...target a broad range of dividing and non-dividing cell types with almost 100% efficiency. Unlike lentiviruses...adenoviruses include transient transgene expression, as well as the substantial immune response induced by the...recombination of adenovirus plasmids in either mammalian cells or microorganisms, including bacteria and yeast....can then be transfected into mammalian packaging cell lines to generate adenovirus particles. Read our...

...abundant forms of posttranslational modifications in cells and research into its many roles in protein function...interactions can be discovered by fluorescence-activated cell sorting (FACS). The mode #2 phosphosite library ... Production of Recombinant Phosphoproteins Using Cell-Free Protein Synthesis. Oza JP, Aerni HR, Pirman...Ordureau A, Paulo JA, Rinehart J, Harper JW. Molecular Cell . 2015. Sep 9. pii: S1097-2765(15)00662-0. doi: ...

... 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC 58982 cut S. pyogenes 24879462 Mello AXIN2 H. sapiens... compiled from plasmids in Addgene's database as well as from sequences provided to us by users (see below...GAACCCGTTGCCGAATACAC 58202 cut S. pyogenes 24879462 Mello unc-58(e665) C. elegans TCCACGCACATGGTCACTA 59931...GGATGGATGTGTAGTCAATT 61250 cut S. pyogenes 25491644 Ward yellow D. melanogaster GGTTTTGGACACTGGAACCG 49331 cut ...

...pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell 135634 pAAV-S5E2-ChR2-...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...Fluorophore GFP Red-wavelength fluorescent protein Yellow-wavelength fluorescent protein Blue-wavelength ...

...plasmids that encode monoclonal antibodies to zebrafish cell surface receptors and secreted proteins....plasmids that encode monoclonal antibodies to zebrafish cell surface receptors and secreted proteins. The plasmids...antibodies are produced by transfecting mammalian cell lines and collecting the secreted monoclonal antibody...

...Fluorescent Protein Resources: Empty Backbones FRET Subcellular localization Optogenetics The lab of Michael ...Backbones mEmeralds Reds Blues Cyans Oranges Greens Yellows Photoactivatables Empty Backbones Plasmid Description...Description Industry Greens Plasmid Description Industry Yellows Plasmid Description Industry Photoactivatables ...

... Modeling Neuroendocrine Tumors Using Adult Stem Cell-Derived Organoids Matthew Meyerson Dana-Farber Cancer...Institute Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Qiao Zhou Harvard University...University Epigenetic Regulators of Intestinal Endocrine Cells and Carcinoid Tumors Bradley Bernstein Broad Institute...

...Collection Allen Institute for Cell Science Plasmid Collection New England BioLabs Cell-Imaging Plasmid Collection...Botman-Teusink Yeast FP Collection Protein Expression Cell Migration Consortium Malate Dehydrogenase CUREs ...

...83899 pAAV-mDlx-GCaMP6f-Fishell-2 Dlx GCaMP6f none Constitutive 1, 9, rg* Fishell 100833 pAAV.Syn.Flex.GCaMP6f.WPRE.SV40... GCaMP7 GCaMP6 axon-GCaMP6 soma-GCaMP6 Twitch2B Yellow Calcium Sensors jYCaMP1 axon-jYCaMP1 Red Calcium...pAAV-CAG-NIR-GECO2G CAG NIR-GECO2G none Constitutive 1, 2, 9 Campbell Calcium Sensor: HaloCaMP1a 138327 pAAV-synapsin-HaloCaMP1a-EGFP...

...to activate programmed cell death or dormancy for phage-infected bacterial cells so as to limit the spread...population. Type VI enzymes that function in mammalian cells can be used to attentuate RNA levels. In mammalian...

...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ); a mechanism...introduced along with the Cas9 and gRNA plasmids, the cell may instead repair the break using homology-directed...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

...developments with CRISPR-Cas9 gene editing have propelled both reverse and forward genetics of these parasites...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...

...Initiative Collection Cell Migration Consortium Center for Genome Engineering EXtracellular Plasmid RESource...Mammalian RNAi Microbiology Plant Expression Stem Cells Synthetic Biology Tet Inducible Expression Worm ...

...Tesson et al., Nat Biotechnol. 2011 ) Human somatic cells ( Miller et al., Nat Biotechnol. 2011 ; Reyon and...., Nat Biotechnol 2012 ) Human pluripotent stem cells ( Hockemeyer et al., Nat Biotechnol. 2011 ) TALE...TALE transcriptional activators in human cells ( Maeder et al., Nat Methods 2013 ) More detailed information...

...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

...sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ), a mechanism...PAM site. When a repair template is present, the cell may repair a DSB using homology-directed repair ...Cas protein and a target-specific gRNA in the same cell at the same time. Single plasmids containing both...

...a typo in the latest draft of your dissertation. Well, that will probably never happen. Yet with transcription...summer of 2011 and has already become the best-selling kit in Addgene’s history. Dr. Keith Joung’s lab.... Targeted gene disruption in somatic zebrafish cells using engineered TALENs. Sander JD, Cade L, Khayter...