...NLS-mRuby2 Control Gradinaru 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell...this serotype to deliver Cre-dependent transgenes in Cre transgenic lines. As part of our standard viral...serotype permits robust retrograde access and transgene delivery to projection neurons. Specific classes...titering by SYBR green qPCR , confirmation of the transfer plasmid with PCR, purity assessment by silver ... viral prep format. Please note this does not guarantee viral vector packaging service, but lets us know...

...crevices proteins on the cell surface. Figure 1: Comparison of common antibody, HCab, and nanobody...Humana Press, pp 133–148. https://doi.org/10.1007/978-1-62703-293-3_10 Walter J et al. (2020) Synthetic nanobodies...sybodies against membrane proteins Developing antibodies against proteins embedded in membranes is tricky because...develop antibodies against unstable targets like membrane proteins that may unfold due to camelid high body...synthetic nanobodies, called sybodies, against membrane protein targets in as little as 3 weeks (Zimmermann...lab can quickly select for sybodies targeting a membrane protein of interest using the Sybody Generation...have a concave, loop, or convex scaffold and are randomized with a defined set of different trinucleotides...

...phosphorylated DNA termini to 3 ́-OH DNA termini (1-4). In vitro, ligases (notably T4 DNA ligase) are ... enzymology of DNA repair enzymes.     References 1. Shuman, Stewart, and Christopher D. Lima. "The polynucleotide...thermostable DNA ligase-encoding gene." Gene 109.1 (1991): 1-11. PubMed PMID: 1756968. 7. Lauer, G., et al. "Cloning...19329793. PubMed Central PMCID: PMC2719376. 5. Barany, Francis. "Genetic disease detection and DNA amplification...1986365. PubMed Central PMCID: PMC50775. 6. Barany, Francis, and David H. Gelfand. "Cloning, overexpression...Central PMCID: PMC208194. 8. Luo, Jianying, and Francis Barany. "Identification of essential residues in Thermus...(1989): 245-254. PubMed PMID: 2753355. 12. Barany, Francis. "The ligase chain reaction in a PCR world....

...expressing additional EBNA-1 transiently. The transiently expressed EBNA-1 increases protein expression...are based on the Epstein-Barr Nuclear Antigen-1 (oriP-EBNA-1) system where each vector contains a viral ...replication, OriP and the EBNA-1 sequence that encodes for the DNA binding protein EBNA-1 [7]. These two sequences...extra plasmid, pCXWB-EBNA-1 is used in the reprogramming cocktail. pCXWB-EBNA-1 lacks oriP and is unable...pCXLE vectors listed below in Table 1 are available at Addgene. Table 1: List of pCXLE episomal plasmids,... and shRNA against p53 pCXWB-EBNA1 37624 transient EBNA-1   Many thanks to our guest blogger, Kusumika...obtained and the subsequent reprogramming success [1]. Fibroblasts need to be cultured and expanded in ...

...between strand 10 and 11 to yield large (1-10) and small (11) fragments. In several cases an FP(1-10) fragment...General Design Figure 1: Two proteins are fused to the FP(11) and FP(1-10) fragments. When Protein...Description Article PI Blue EBFP2 EBFP2(1-10) and Capri(1-10) for use with GFP(11) Multiplexed labeling...Commun. 2017 Bo Huang mNeonGreen3 mNG3K(1-10) and mNG3A(1-10) for use with mNG2(11) Improved yellow-...sfCherry2 sfCherry2(1-10) and sfCherry2(11), also photo-activatable variant PAsfCherry2(1-10) Improved split...brings the pieces of the FP back together (Figure 1). This method is generally known as Bimolecular Fluorescence...even from a different base FP (for example, EBFP2(1-10) can be used with GFP(11)). Some of the articles...

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter... CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

...sequences containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than...population. Some cells may be wild type due to either (1) a lack of gRNA and/or Cas9 expression or (2) a lack... in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80. PMID: 25357182...For easy-to-transfect cell types (e.g. HEK293 cells), transfection with standard transfection reagents may...mammalian cell line that can be transfected at high efficiency Lentiviral transduction Cas9 and gRNA can be present...present in a single lentiviral transfer vector or separate transfer vectors May contain reporter gene ...screens using CRISPR AAV transduction CRISPR elements are inserted into an AAV transfer vector and used to ...

...making it easier for us to do our work.” References 1. Athanasios Lampropoulos et al. "GreenGate - A Novel...terminators and resistance cassettes for selection of transgenic plants. The complete GreenGate toolkit, now available...the time required to generate multi-construct transgenic plants. In the most practical terms, what GreenGate...Versatile and Efficient Cloning System for Plant Transgenesis." PLoS ONE. 8(12): e83043 (20 December 2013)...

...    Figure 1: A 1 mg/mL control is diluted in a series ranging from 1:2 to 1:32. Each individual...series that ranges from 1:2–1:32. The specific dilution series used will depend on the expected concentration...the data points fit the trendline. R2 ranges from 0 to 1 with 1 being a perfect fit and 0 indicating that...example, Figure 1 depicts a 2-fold dilution series. Each step of the series dilutes by 1:2 for a series...individual step of the series is consistent at 1:2. When preparing a dilution series, use a new pipette tip for...concentration lies within the dynamic range of the curve. The dynamic range is the linear span between the lowest...the dynamic range of your standard curve, so if your sample does not fall within this range, it may be ...

...just make their own buffers when the kits buffers ran out. Homemade buffers performed the same as those...series to increase binding capacity. Figure 1: Purify DNA using glass filters. Image: Kim and Morrison...a gravity-based column plasmid maxiprep kit takes 1-1.5 hours to complete, while this syringe-based method... solution. NaI has two purposes in this protocol: 1) it solubilizes both DNA and agarose, and 2) it helps...property and developed a protocol that uses Whatman No. 1 paper or even paper towels to purify DNA and RNA from...rather a glass powder slurry that has a milk-like appearance. To make DNA stick to the glass particles in ...the Patterson Protocol was shown to purify DNA ranging in size from 100 bp to 48 kb with high yields and...

...cells transduced with lentiCas9-blast. A549 cells were transduced (MOI = 37) and selected with 1 µg/mL...expressing Cas9 via transduction with Cas9 lentiviral vector, lentiCas9-Blast (52962-LV, Figure 1). Some cells...were frozen down. Figure 1: Cas9 expression in A549 cells transduced with lentiCas9-blast. Anti-Cas9...of the gel in the BRAF gRNA-transduced samples (data not shown). Pro-Tips: 1.Designing primers against ...The entire process from start to finish took about 1 month. Cas9 delivery Overview: Before any editing...Western blotting is a loading control. Pro-Tips: 1. It’s all about the MOI. In retrospect I used a way... pool had wildly variable Cas9 expression (Figure 1). This is a problem because Cas9 expression affects...

...). Analysis of Transduction Efficiency, Tropism and Axonal Transport of AAV Serotypes 1, 2, 5, 6, 8 and...Overview. Cells, 12(5), 1–41. https://doi.org/10.3390/cells12050785 Murlidharan, G., Samulski, R. J., &... ONE, 9(8), 1–10. https://doi.org/10.1371/journal.pone.0106472 de Backer, M. W. A., Brans, M. A. D., Luijendijk...vector-mediated transduction of the corticospinal tract: Comparison of four promoters. Gene Therapy, 28(1–2), 56...the selection process. Factors to think about are (1) your experimental conditions and measurements; (2...serotype, promoter, and titer.     Figure 1: Flow chart depicting a) steps for selecting serotypes...injection site than AAV2 (Watakabe et al., 2015) (Figure 1). You’ll need to consider if such properties could...

... Table 1: Transduction efficiency of AAV-PHP.B versus AAV-PHP.eB in the CNS. A GFP transgene was packaged...marker). Check out tables 1 and 2 below for a summary of the quantified transduction efficiency of AAV-PHP.eB... AAV.PHP.S’s great neuronal transduction efficiency, as shown in tables 1 and 2, with a cell-type specific...nervous system (CNS). AAVs are popular tools because: 1) their genomes are easy to manipulate, 2) they have... AAV vectors. What can these AAV’s be used for?  1. Multi-color labeling of neurons Multi-color labeling... dendrites extend to. The keys to this method are 1) high levels of color diversity so that cells are ...expression into a two part system (figure 4d):  Part 1: A cocktail of three AAV vectors expressing RGB proteins...

...outside of the antibody’s dynamic range. Specifically, the 1:2, 1:1, and No dilution samples all have ...dilution range from 1:100–1:1,000. If your antibodies come from ascites fluid, try a dilution range from ...with a recommended dilution and/or range (typically between 1:500 and 1:10,000 for primary antibodies). ...from 1:1,000–1:100,000. Secondary antibodies For secondary antibodies, the recommended dilution range is ...is usually between 1:5,000 and 1:200,000. Check the manufacturer’s recommendations, and if needed, optimize...marked on the membrane (1) using the gel as a guide. The gel is then removed from the membrane (2) and the...Mark your membrane! Membranes look the same from both sides, so it’s quite easy to think lane 1 is‌ lane...

... assembly reaction** 1 5 min., 37 ºC (2.5 μl) 687 100% 274,200 2,742,000 1 60 min., 37 ºC (2.5 μl)... volume of the 1 ml outgrowth spread on each transformation plate can be manipulated to result in appropriate...Figure 3, Table 1). These improvements (5- to 12-fold increases in the number of transformants while maintaining...expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed a mixture... obtained from 1-, 12- and 24-fragment assemblies of the lacI/lacZ cassette, and illustrates how the volume...fidelity studies conducted by Potapov et al. at NEB (1, 2). While T4 DNA Ligase, the mainstay of most biotechnological... 16 ºC) x 30 (100 μl) 78 90.7% 783 9,792 Table 1. Yields and fidelities for Golden Gate Assemblies ...

...recombineering system has three components (Figure 1): 1) Exo, 2) Beta, and 3) Gam. All three are required...generate 2 possible products: 1) a partially dsDNA duplex with single-stranded 3’ overhangs or 2) if the ...sequence of the translated protein.  These changes can be 5’ or 3’ of the desired change.   Table 1: Overview...recombineering with an ssDNA oligo substrate.   Figure 1: Components of the Lambda Red Recombineering system...and tags.  The typical frequency of recombinants is 1 positive clone out of 104 to 105 colonies. Pro Tip... with a recombination frequency between 0.1% to 1%, and can be increased to as high as 25-50% by designing...replication. There are two ways to avoid activating MMR: 1) use a strain of bacteria that has key MMR proteins...

...They help us to transform raw genomic coordinates into meaningful experiments. Table 1: An emerging family... chromosome, start, and stop. For instance (chr3, 1, 10) indicates a stretch of DNA at the very beginning...genetic elements like protein, RNA, and DNA (Table 1). As with GPS in the real world, coordinates alone...enhancers with the help of genome math. Figure 1: Genome math illustrated. Intersect (left) and set...histones with “GPS for proteins,” ChIP-seq from Table 1. Because of DNA’s 3D geometry and the chemical properties...experiment to identify the critical NANOG binding sites: 1. Find Enhancers that have NANOG binding sites 2. Design... In order to denote the NANOG enhancers from step 1 with genome math, we’ll need a bit of shorthand from...

...like uneven pipetting or irregular membrane transfer. Figure 1: A loading control is a type of positive...because the loading control band is weaker in condition 1 than condition 2, the normalized values for the two...to using loading controls accurately. Assumption #1: The loading control is not perturbed by the experiment...without your knowledge? If you can’t trust Assumption #1, any change in the normalized intensity of your POI...interest band is significantly lighter in “condition 1” than “condition 2.” By eye, the loading control appears... the protein abundance axis, both blue “condition 1” points (POI and loading control) are smaller than...assumptions discussed above into question. Assumption #1: The loading control is not perturbed by the experiment...

...Inactivation of AAV Serotype 1 Vectors. Human Gene Therapy Methods, 28(1), Article 1. https://doi.org/10.1089...commonly called “triple plasmid transfection” (Figure 1).    Figure 1: Overview of key steps of AAV production...repeat sequences. Human Gene Therapy Methods, 23(1), Article 1. https://doi.org/10.1089/hgtb.2011.034 Benyamini...in the CNS. Molecular Neurodegeneration, 15(1), Article 1. https://doi.org/10.1186/s13024-020-00361-z ..., expressing Ad E1A and E1B, can be transfected with your transfer plasmid, carrying your gene of interest... performed 12–18 hours post-transfection to help remove toxic transfection reagents and keep the cells...cells happy. Harvesting virus Once you have transfected your cells, wait 2–5 days and then collect the supernatant...

...loops 1 and 6 resulted in light controlled binding, but with opposite effects: insertion into loop 1 caused...experiments.  AsLOV2 Inertion Site mCherry #1 mCherry #2 GFP Loop 1 dark-induced dark-induced dark-induced...favorite protein (YFP). You have two options:  Option #1: Affinity tag purification You tag YFP and use an ...and one against GFP. Insertion of AsLOV2 into loop 1 always generated OptoNBs with dark-induced binding... induced dark-induced blue-light induced Table 1: Summary of the effect of AsLOV2 insertion site on...let the team detect its co-localization with a membrane-localized mCherry or GFP protein. With this system...bind, it co-localizes with its target at the cell membrane and when the OptoNB can’t bind, it localizes to...