...boxes that the tips come in often indicate a volume range that the tip can hold. This should give you an idea...

... ml B + 200 mM NaCl Procedure Cover the filter membrane with 15 mL of 0.1% Pluronic F68 PBS and incubate...

...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter... CYC1 GCGTGAATGTAAGCGTGAC (Invitrogen) CYC1 transcription termination signal, reverse primer DsRed1-C ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab...

...protocols, our educational resources cover a wide range of topics in molecular biology, laboratory research...Protocols Find written and video protocols for a wide range of applications in molecular biology, plasmid cloning...virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol...

...First Edition, trans. About CRISPR 101 en español January 2024 | First Edition, trans. About Una traducción...and management, resources for identifying your transferable skills, and tips on the job application process...

...Barcoding libraries contain plasmids with unique, semi-random sequences that can be used for applications like...large numbers of cells minimizes the effects of random chance that could lead to false positive or negative...