...promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC...

...often made Cre-dependent. If Cre-dependent vectors are used in transgenic animals that express Cre in only...conditional mutant mouse brain that expressed Cre recombinase only in pyramidal cells of the hippocampal ...labelling the subset of infected cells that also express Cre. Another advantage of AAV vectors is that there are... traced neurons with an AAV9 vector expressing a Cre-dependent fluorescent marker. Injection into a conditional...PMID: 4107258. Lo, L., and Anderson, D.J. (2011). A Cre-dependent, anterograde transsynaptic viral tracer...

...of sequence-specific enzymes (e.g. nucleases, recombinases) which irreversibly excise or invert a specific...upon these findings by screening for additional activation domains that increase the expression of target...Synchronization of secretory protein traffic in mammalian cells The journey of secretory proteins, from their... mutagenized and screened for speed and voltage sensitivity. This hierarchical screen led to the generation...has modified the RNA-guided CRISPR-Cas9 system to create a tool that is quick, versatile, and robust. Dubbed...adopt basic biological concepts and employ them in creative and innovative ways. The principle of protein ...molecule imaging and inducible gene expression by creating the SunTag system. The SunTag system, named after...