...comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order individual...streamline identification. While the Zhang lab controlled their multiplicity of infection so that a single...disease depends on both genetic and expression control systems to mimic illness on a molecular level. ...

...function of Your Gene Of Interest (YGOI) in a controlled environment under various conditions. The first...great for overexpressing YGOI in an isolated, controlled environment. In most cases bacterial expression...using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following the expression pattern... allow you to visualize YGOI in vivo (try pcDNA3-EGFP). If you can get away with generating transiently...

... should contain a reporter DNA sequence (such as GFP) in the sense orientation, followed by coding sequence...transduced reporter gene. Generating a FLEx switch to control expression of an optogenetic reporter would ensure...et al. Nat Biotech 2003): In the presence of Cre, GFP expression is lost, allowing for rescued expression...

...protein. With this control set, you should see your target protein IP’d in the positive control sample but not...permanently altering the structure of the protein.  Controls As with any experiment, it is critical to include...include proper positive and negative controls for an IP. When possible, perform the IP in parallel with ...interest and a sample that does not. Common negative controls include knockout cell lines or tissues that do... not in the negative control, confirming that the capture antibody is functioning as expected. In order...perform parallel IPs with beads only and an isotype control antibody. Alternative applications Oftentimes, ...In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest ...

...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...

...blot showing GFP expression in cells that have been transfected with a plasmid encoding GFP. Actin, a common...detection. You’ll also want to use the appropriate controls for your experiment to account for potential non-specific...quantitatively if you also load the gel with appropriate controls for normalizing the protein concentration. To ... common internal control for Western blots, shows that a similar concentration of cell lysate was added...

...hiPSCs  EMX1  67% Mouse BM cells from GFP transgenic mouse  GFP  ~60-65% Human hepatocytes  Myd88  ~...editing in their livers, while non-injected and control gRNA injected mice had no detectable editing. Additionally...

...various combinations of protein tags (His, Avi, and GFP) as well as protease sites to facilitate protein ...’ end of the leader sequence. Using a variety of GFP and RFP fusions as their test genes, the researchers...terminators of varying strengths centered within GFP/RFP bicistronic reporters characterized in Cambray... Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter."ACS chemical biology 11.1...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...be conveniently performed through the N-terminal eGFP tag carried on all constructs. The Cell-Free Protein...

... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...

... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

...factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for other plasmids... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library...

...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz 60323 pGL4.23...fusions in plants. Renilla luciferase under the control of a CMV promoter is present for normalization ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization Ting Ni ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization. Modified...

...placing FP timer DsRed-E5 under the control of Neurog3 (a gene controlling pancreatic differentiation) in ...synthesized or long-lived transcription factors control gross changes in gene expression as new body sections...Pratik, et al. "A programmable synthetic lineage-control network that differentiates human IPSCs into glucose-sensitive...Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your Fluorescent Protein...

...target genes. The sequence of the promoter region controls the binding of the RNA polymerase and transcription... all the time while others are more carefully controlled. Regulated promoters might act only in certain... light. In the cell, promoters themselves are controlled by still other regulatory factors: enhancers,...induced. Requires T7 RNA polymerase, which is also controlled by lac operator. Can be induced by IPTG. Commonly...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...

...mouse brains expressing green fluorescent protein (GFP) (6).   The Dodt and Frank Bradke laboratories later...subpopulation of neurons are brightly labeled with GFP (e.g. Thy1-YFP-H mice).  However, we recently developed...use of viruses allows much better spatiotemporal control over labeling methods as compared to transgenic... nerve afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical...

...from the Church lab uses this system to control expression of GFP.)  To turn this inducible system into ...Promoters control the binding of RNA polymerase and transcription factors. Since the promoter region ...promoters can be regulated via positive or negative control. Positive Repressible: An activator protein is ...system, Gossen and Bujard created the tetracycline-controlled transactivator (tTA). They fused TetR with the...interest to be expressed. These permit exquisite control of gene expression and tracing of gene expression...that sometimes it is necessary or desirable to control or look at multiple genes at the same time.  The... genetic analysis in Drosophila or for precise control over multiple genes in synthetic systems. Recent...

...Arabidopsis, and corn. For both β-glucuronidase (GUS) and GFP reporters, as well as multiple transient and transgenic.... The kanamycin antibiotic resistance gene is controlled by a weaker constitutive Nos promoter, and it...

... pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)...contains a human codon optimized dcas9 gene under the control of Murine Stem Cell retroVirus LTR promoter. The...pgRNA_humanized ) contains a murine U6 promoter controlled sgRNA cassette, wherein the GN19 can be custom...as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Qi LS, Larson MH, Gilbert LA...vector (Leu2) that contains dCas9 fused to NLS controlled by TDH3 promoter 46921 pTDH3-dCas9-Mxi1 Yeast...and sgRNA targeting GAL4 UAS promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector...Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1...

...containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA (FUW-M2rtTA...your gene and the marker can be placed under the control of two different promoters. Both the single and...derivative such as Doxycycline (Dox), the Tet-controlled transactivator (tTA, also expressed by your transfer...viral titre to the number of cells transduced by a GFP encoded virus, and the reverse transcriptase activity...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...