Skip to main content
Addgene
Showing: 81 - 100 of 514 results
  1. Plasmids 101: The protein expression toolbox

    Type
    Blog Post
    ...Tet-on transgene vector. Degron tags Tagging relevant proteins with a degron tag can provide inducible protein...systems work by tagging the endogenously or exogenously expressed protein with the relevant tag and then introducing...ligand to mark the tag and whatever it is fused to for degradation. Since the tagged protein of interest... are akin to degron tags, just with a flipped mechanism. When a protein is tagged with a DD, it is unstable...auxin-inducible degron (AID), and degradation tag (dTAG). These control systems function at the post-translational...Check out Addgene's Lentiviral dTAG cloning vector and SMASh degron tagging vector! Destabilizing domains...quickly recover once the ligand is removed. Degron tag systems include small molecule assisted shut off ...
  2. Adeno-associated Viruses (AAVs) for Genome Editing

    Type
    Blog Post
    ...pAAV-TK-Acceptor has a conventional heterologous promoter-driven TK-neoR gene. To modify these tagging vectors ...their lab include using AAV to introduce epitope tags into the endogenous alleles of the p53 and PTEN ...allele of the STAG2 tumor suppressor in human cells (Kim et al, 2016). The Waldman lab has designed their...their AAV tagging vectors (pAAV-SEPT-Acceptor and pAAV-TK-Acceptor) so that they can be easily adapted ... introduction of heterozygous endogenous epitope tags, or the introduction of dominant mutations of a ...: PMC373311. 3. Kim, Jung-Sik, et al. "Epitope tagging of endogenous genes in diverse human cell lines... at the Georgetown University School of Medicine has used this gene editing system frequently over the...
  3. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ... well as additional useful tags, including 3xFLAG epitopes, TEV and BioTag, which can be used in protein... protein effectivity), and a fluorescent protein tag for visualization (Fig. 1b). While the probes target...ultimately leading to the degradation of the AID-tagged protein. To quantify protein degradation the Ward...44 amino acids auxin inducible degron sequence) tagged proteins. Degradation of your protein interest ...Gibson and Saptrap cloning systems to generate AID* tagged CRISPR knock-in repair constructs. These repair...repair constructs can be used to integrate the tagged AID* into genomic sites of interests via CRISPR techniques...Cecchetelli The auxin inducible degron (AID) system has been extensively used in C. elegans since 2015 to...
  4. SunTag and Fluorescent Imaging

    Type
    Blog Post
    ...superfolder GFP (sfGFP) with the small solubility tag GB1. In SunTag nomenclature throughout the rest of this ...tracking Caveats of SunTag Very large size: a 24x scaffold fully occupied with GFP has a molecular weight...References 1. Tanenbaum, Marvin E., et al. “A protein-tagging system for signal amplification in gene expression...concerns are greater with SunTag. v1 SunTag exhibits some scaffold aggregation (v4 Suntag does not.) It’s up...may be toxic to the cell. Here comes the SunTag How does SunTag fix these problems? Instead of directly...power of SunTag for single molecule imaging, finding that plasma membrane-targeted CAAX-SunTag was 18-fold...traditional FP fusion, a SunTag fusion could be used as well. Pros of SunTag compared to traditional ...
  5. Hot Plasmids - May 2022

    Type
    Blog Post
    ...overview). Until recently, the approach has been hampered by the need to tag each protein of interest and, for... any transgenic zebrafish line expressing a GFP-tagged version of a protein of interest. The binding of...labeling proteins in close proximity to the GFP-tagged protein (albeit slightly offset due to the nanobody-GFP...   By Ashley Waldron Proximity-dependent labeling has become a powerful approach for proteomic mapping ...M-CREATE) by: Brian O'Neill  The Viviana Gradinaru Lab has previously developed the multiplexed version of the...sequence knock-ins by: Lucie Wilson Le Cong’s lab has developed a method using dCas9-SSAP to knock-in long... methods for large inserts. However, this system has a much lower error rate. For a one kilobase insertion...
  6. Antibodies 101: Selecting the Right Antibody

    Type
    Blog Post
    ...antibodies against the same target; tagged protein strategies that express a tagged version of the antigen and ...An antibody that has been cited thousands of times may be a safer bet than one that has never been used...compare staining of the antibody to that of the anti-tag antibody; and immunoprecipitation-mass spectrometry...work. Whenever possible, choose an antibody that has been validated in your specific application. Consider...cross-reacts with. Ideally you will find an antibody that has been validated in the species your protein of interest.... Talk with your peers. If someone in your field has used the antibody before you will not only have peace...Uhlen, 2016). Be sure that the antibody you choose has been validated using one or more of the proposed ...
  7. Hot Plasmids - September 2019 - CRISPR, Auxin Inducible Degradation, MerMAID Channelrhodopsins, and Genome Looping

    Type
    Blog Post
    ... and other tags (Yesbolatova et al., 2019) using CRISPR. This toolkit makes it easy to tag your protein...the Kanemaki lab has created a new toolkit of plasmids for the N- or C- terminal tagging of proteins with...here.        New toolkit for N or C terminal tagging of proteins for degradation using AID Article contributed...specific ubiquitin ligase pathway needed for AID. By tagging proteins with a 7kD degron called mAID and expressing...previously developed a CRISPR/Cas9 based method to tag endogenous proteins in HCT116 cells with mAID. Using...inhibitor, sufficiently suppresses basal degradation of tagged proteins, a common problem of the AID technology...technology (Yesbolatova et al., 2019). Find the mAID tagging toolkit at Addgene Yesbolatova et al., Methods,...
  8. Molecular Biology Reference

    Type
    Guide
    ...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...
  9. Hot Plasmids - December 2019 - CRISPR pooled library, LipoGlo, CRISPRa, and Voltage Imaging Tools

    Type
    Blog Post
    ... size distribution and concentration of ApoB-LPs has been shown to have a strong correlation with cardiovascular...indicators difficult to work with.  The Gottschalk lab has surveyed a range of microbial rhodopsin GEVIs in ...information. Such voltage imaging can be performed in intact animals and offers many advantages over traditional...found several voltage biosensors and conditions that can be used to monitor real time voltage changes in ...2019. PubMed PMID: 31451697. Genetically encoded voltage indicators for use in worms Article contributed...contributed by Brook Pyhtila Genetically encoded voltage indicators (GEVIs) change fluorescence in real time when...influence the rhodopsin properties. Find these voltage biosensors at Addgene. Hashemi et al., PNAS. 2019...
  10. Proximity Labeling: A Powerful Tool for Protein Complex Purification and Proteomic Mapping

    Type
    Blog Post
    ...cell surface proteins with a biotin tagged LPETG peptide. Biotin tagged proteins can then be purified using...kD TurboID, which has 15 mutations compared to BirA and the 28kD miniTurbo, which has the N-terminus domain...easily purify and identify any proteins that are tagged with biotin using avidin coated purification techniques...engineered ascorbate peroxidase (APEX), used as a genetic tag for electron microscopy, could be used for efficient...living cells via spatially restricted enzymatic tagging." Science 339.6125 (2013): 1328-1331. PubMed PMID...proteins in minutes rather than hours like BioID. APEX has allowed scientists to identify the proteomic map ...BioID was developed in 2012, proximity labelling has become a powerful technique for studying protein-...
  11. Deep Mutational Scanning with One Pot Saturation Mutagenesis

    Type
    Blog Post
    ...When your gene of interest has a BbvCI site(s). If so, the nicking mutagenesis protocol will still work ...instances where it does. 1) When the backbone vector has multiple BbvCI sites. If these sites have opposite... as template for a site-directed mutagenesis PCR that uses mutagenic primers to introduce all desired ...effects. One-pot saturation mutagenesis The one-pot saturation mutagenesis technique described in Wrenbeck... single mutagenic primer pair to generate an individual mutant, this technique uses mutagenic primers ...saturation mutagenesis with the same protocol. What do you think about one pot saturation mutagenesis? How .... “Random Mutagenesis by Error-Prone PCR”. Methods in Molecular Biology In Vitro Mutagenesis Protocols...
  12. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    ...appealing, but the disadvantages must be carefully considered before using. For example, the tag may affect the... epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest on the C- or N-terminus. ...called a pull-down assay, an antibody against the tag is used to isolate the protein of interest. The wide...interfere with protein interactions of interest. Tagged proteins are typically expressed at much higher...proteins. Data obtained from experiments using a tagged protein may not be translatable to the endogenous...agents. Directly conjugating the primary antibody has the additional benefit of permanent linkage. This...steps following the incubation step. The wash buffer has an optimal pH and ionic strength that breaks weak...
  13. Using Phosphoserine to Study Protein Phosphorylation

    Type
    Blog Post
    ...response to the presence of TAG sequences in ORFs. In this bacterial strain, TAG is an ‘open’ codon, which...ΔA. Because the phosphorserine OTS recognizes the TAG amber stop codon, using the OTS in an unmodified ... recoded to eliminate all 321 amber stop codons (TAG), replacing them with TAA (7). This modification ...through the production of full-length protein (the TAG codon should encode phosphoserine instead of a stop...protein. Up to 80% p-Ser incorporation into E17TAG GFP has been achieved with the Rinehart system (6);...can run samples on SDS-PAGE gels containing Phos-Tag, a small molecule that binds specifically to phosphate...SepOTSl can encode a non-phosphorylated serine at the TAG codon of the same expression vector used for phosphoserine...
  14. Live and Let Dye: Self-Labeling Protein Tags

    Type
    Blog Post
    ...Characterization of the Self-Labeling Protein Tags HaloTag7, SNAP-tag, and CLIP-tag. Biochemistry, 60(33), 2560–2575...genetic tag on the protein of interest. Table 1: Summary of popular self-labeling tag systems Tag Size...self-labeling protein tags. The basics These tags most often consist of an enzyme that has been mutated to ...than short peptide tags like tetracysteine (Jing & Cornish, 2011). HaloTag and SNAP-tag are the most popular...application, SNAP-tag, CLIP-tag (both 182 aa), and eDHFR (159 aa) are smaller than HaloTag (295 aa) – for...resorufin). SNAP-tag: In 2003, Kai Johnsson’s lab developed a self-labeling fusion tag based on the human...later became known as SNAP-tag. There is also a fast-reacting version of SNAP-tag called SNAPf. eDHFR: The...
  15. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...
  16. Illuminating Choices: A Guide to Selecting Fluorescent Dyes and Ligands

    Type
    Blog Post
    ...would be SNAP-tag® and HaloTag®. These consist of a genetically encoded enzyme variant tag that covalently...several advantages to using these self-labeling proteins over traditional fluorescent protein tags, such...endogenous target, and thus no genetically encoded tag is required. These dyes can also be attached to an...ligands have more flexibility due to the affinity tag they typically bind to. Stability of fluorescence...experimental labeling. Size is also a factor. Bulkier tags, such as GFP, may interfere with protein expression...fluorescent experiments, such as using fluorescently tagged ligands or intermolecular FRET for ligand-receptor...should possess high specificity to ensure accurate tagging. In Fluorescence Resonance Energy Transfer (FRET...
  17. Even more elegant: Single injection CRISPR/Cas9 in C. elegans

    Type
    Blog Post
    ...time. Creating a modular, selection-based gene tagging approach Multiple features of C. elegans have made... between a fluorescent protein (FP) and a 3xFLAG tag (see construct schematic below.) After self-excision...intron, and only the fluorescent protein and 3xFLAG-tag sequences are inserted into the genome. Figure...template plasmid to create fluorescent and 3xFLAG-tag fusion proteins. The repair template and Cas9-sgRNA.... (2015) illustrating the steps to fluorescently tag a C. elegans protein. The his-72 locus is shown as...little hands-on labor and could facilitate the tagging of every protein in the C. elegans genome. Although... gene tagging...
  18. Hot Plasmids - March 2019 - Anti-CRISPR, 2in1 Cloning, Fluorescent Voltage Indicators, and Photoswitchable Proteins

    Type
    Blog Post
    ...binary 2in1 vectors with all possible combinations of tag orientation (NN, NC, CN, and CC). The 4 kits also... Archon1 is  bright, exhibits good localization, has high signal:noise ratio, high sensitivity, responds...levels are more evenly controlled. The Grefen Lab has utilized the 2in1 cloning system to generate a series...fluorescent voltage indicator Archon Article contributed by Shreya Vedantam  Listen to the voltage indicator...turned to genetically encoded voltage indicators. To expand the voltage indicator toolbox, Ed Boyden’s...fluorescent voltage indicator. Archon1 can embed itself into the cell membrane where cell voltage can then...vectors (pUC57-L1L4 and pUC57-L3L2) that offer the advantage of using restriction digest cloning to introduce...
  19. Better Dyeing Through Chemistry & Small Molecule Fluorophores

    Type
    Blog Post
    ...concept include: Self-labeling tags (e.g., SNAP-tag, HaloTag, TMP-tag) – These widely used systems consist...strategies have two parts: (1) a genetically encoded “tag” expressed as a fusion with your favorite protein...fluorophore-contianing “ligand” that binds to the tag. Like most good ideas in biological imaging, the ...genetically encoded tetracysteine (Cys4) peptide tag could be used to label proteins in cells (Figure ...consist of a genetically encoded enzyme variant tag that reacts specifically and irreversibly with a small... attachment of a fluorophore ligand to a peptide tag (Figure 1c). Click chemistry (e.g., transcyclooctene–tetrazine...paclitaxel. Unlike other systems, no genetically encoded tag is required as the small-molecule binding motif targets...
  20. Antibodies 101: Single Chain Fragment Variables (scFvs)

    Type
    Blog Post
    ...in living cells. The HA frankenbody is an HA tag detection probe. It contains an HA-binding scFv that’s... The SunTag system uses an scFv to amplify the fluorescence intensity of a tagged protein. SunTag has ...about the SunTag system which uses an scFv to amplify the fluorescence intensity of a tagged protein. ...two components: 1) a protein of interest that’s tagged with 10-24 copies of the short epitope GCN4, also...often genetically fused to other proteins, which has led to their application for basic and translational...s fused to a fluorescent protein such as GFP. The HA frankenbody works just like an antibody-based probe...of cytotoxic granules from the T cell. When a CAR has an scFv that binds cancer-related antigens, binding...
Showing: 81 - 100 of 514 results