... from audiences as they do science outreach and engage with the public, and learn from the process of ...broader impacts for their work in education and policy and to draw attention and support to work in their...

...Editing the PAM prevents the prime editor from re-engaging with DNA it has already edited. Created with BioRender.com... La to protect the end of the pegRNA. Adding 3′ polyU tracts to the end of pegRNAs (but not epegRNAs) ...

...engineered SpCas9 variants with alternative PAMs like NGAG and NGCG and SaCas9 with an NNGRRN PAM by mutagenizing...catalytically dead SpCas9 (dCas9) fused to the bacterial polymerase subunit ω. This construct is designed to activate...

..., including investigations into environmental pollutants and health, embryo growth, brain function, and...blocking initiation or splicing. (RNAi, in contrast, engages existing gene regulatory mechanisms to block activity...

... Fig. 2: Prime editor engaging target DNA. The reverse transcriptase polymerizes DNA onto the target strand...

...sharing cells: the black market of cell biology. Engaging in this practice would seem to save time and money...whether the cell lines had isoenzymes and genetic polymorphisms specific to their origins. This technique is...

...recombinant antibody. They are ~25 kDa single polypeptides that contain the variable light chain (VL) and...When these molecules, called Bispecific T-cell engagers (BiTE®s), bind CD3 on T cells and a tumor-specific...

...lab Writes a lot of grants Varying degrees of engagement with what happens in the lab Official title is...dedicated to different career options from science policy to science communication and much more. I hope ...

... site and contains the desired edit (or edits) engages the prime editor protein. The prime editor consists...transcriptase domain copies the desired edit, directly polymerizing new DNA onto the nicked target strand. The initial...

...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...

..., reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA region, reverse primer CAT-R...vector, forward primer Polyhedrin forward AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer...primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For baculovirus vector with polyhedrin promoter...GAAATTTGTGATGCTATTGC SV40 polyA, reverse primer SV40pro-F TATTTATGCAGAGGCCGAGG SV40 promoter/origin, forward...TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT Bacterial transposon Tn7 ...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...AUG1 promoter, forward primer AUG1 Reverse GAAGAGAAAAACATTAGTTGGC (Invitrogen) For Pichia vectors with AUG1...

...SpCas9 VRER variant 3' NGCG SpCas9 EQR variant 3' NGAG SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, ...159 (3), 647–661. PMID: 25307932 Hilton, I. B., D’Ippolito, A. M., Vockley, C. M., Thakore, P. I., Crawford...