... CAMP cathelicidin antimicrobial peptide CAP18, CRAMP, FALL-39, FALL39, HSD26, LL37 CAT catalase MGC138422...hCD40L CD70 CD70 molecule CD27L, CD27LG, TNFSF7 CECR1 cat eye syndrome chromosome region, candidate 1 ADGF,...CREB, MGC9284 CTSB cathepsin B APPS, CPSB CTSE cathepsin E CATE CTSL1 cathepsin L1 CATL, CTSL, FLJ31037,...phosphoinositide-3-kinase, catalytic, delta polypeptide p110D PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide...and adaptive immune signaling and cell-cell communication. Plasmid...

...Insert Promoter Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Purify A catalytically inactive Cas9 (dCas9) can be used...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...

...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans ... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish Plasmid...Marker PI Publication Xenopus Plasmid Gene/Insert Promoter Selectable Marker PI Publication Parasites ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

...Gene/Insert Selectable Marker PI Publication Base Edit Catalytically dead dCas9 fused to a cytidine deaminase...Insert Promoter Selectable Marker PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...

...contribute to this publication. Citation information for openly shared communication: Adeno-Associated ...Addgene's 2018 AAV Education and Development (AAVED) workshop series. The... The AAV Education and Development ...Details Date: Friday September 21, 2018, 9 AM - 5 PM Location: Addgene, 75 Sidney St, Cambridge, MA, 02139 Organizing...useful to help improve this technology or its application? What are some current obstacles that researchers...prepare and compile resources for this meeting's publication, we are asking participants to share practical...antibodies and recommended dilutions, etc.), novel applications, or any other useful information. Experimental...

... any application Balanced Salt Solution (BSS) An ophthalmic solution suitable for any application TMN200...ordering information. ID Name Promoter Description Category PI 157970 pTR-UF11 chimeric CMV/Chicken Beta actin...When using the AAV2(Y444F) serotype in future publications, please acknowledge Arun Srivastava and cite...When using the AAV2(trpYF) serotype in future publications, please acknowledge Arun Srivastava and cite... using the AAV2(4pMut)dHS serotype in future publications, please acknowledge Shannon Boye and cite Boye...using the AAV6(dbY-F+T-V) serotype in future publications, please acknowledge Arun Srivastava and cite...Strategies for Overcoming Donor-Variation and Implications in Genome Editing. Sci Rep . Oct 19;6:35495....

...Genome Engineering Visualization and Tagging Purification Controlled Expression Reporter Plasmids Reporter...Reporter Plasmids Tagging and Visualization Purification Controlled Expression Reporter Plasmids You may...Bacteria? E. coli are commonly used to store and replicate plasmids of all types, but beyond that, researchers...sites within this plasmid. Return to Top Protein Purification Sometimes looking at a protein inside cells ...and, epitope tags can be used to simplify the purification process. Using plasmids in this collection, ...those tags from the purified protein. Protein purification can be challenging, but once you get it right... 5% sucrose. Other empty vectors for protein purification from the Structural Genomics Consortium and ...

...make targeted epigenetic modifications, researchers have fused catalytically dead dCas9 to epigenetic ... Marker PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...CRISPR plasmids for targeted epigenetic modification, including histone acetylation/demethylation, and...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...enhancer for your gene of interest. Available modifications include: histone acetylation by p300 histone...or MQ1 cytosine demethylation by Tet1 These modifications persist over time and are potentially heritable...tables below for CRISPR plasmids for epigenetic modification in mammalian or plant systems. Mammalian Plasmid...

...superior for less favorable protospacers and applications requiring particularly tight binding. In these...advisable to use the consensus sequence. See the publication for details. A protocol for synthesizing gRNAs...expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48650 PM-SP!TB Bacterial...expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol 48651 PM-NM!TA Bacterial...expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48652 PM-NM!TB Bacterial...expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol 48653 PM-ST1!TA Bacterial...expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol 48654 PM-ST1!TB Bacterial...

...Description Category PI Citation Information When using the Caltech serotypes in future publications, please...Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato...Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-...Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP CAG EYFP, Cre-dependent...Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2...Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10...Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B22...

...Selectable Marker PI Publication Bacteria Plasmid Gene/Insert Promoter PI Publication Drosophila Plasmid...Promoter PI Publication Plant Plasmid Gene/Insert Promoter Selectable Marker PI Publication C. elegans ...Promoter PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Protocols gRNA Design Tools CRISPR Blog Posts Catalytically dead dCas9 fused to a transcriptional activator...

...of a catalytically inactive form of Cas9 (dCas9) plus guide RNA (gRNA) for biochemical purification (Fig...protein such as LexA are subjected to affinity purification (Fig. 1). In enChIP, specific genomic regions...537-548. doi: 10.1093/dnares/dsx023. PubMed . Identification of physical interactions between genomic regions...10.1111/gtc.12341. Epub 2016 Feb 5. PubMed . Identification of non-coding RNAs associated with telomeres...26. doi: 10.1186/s12867-014-0026-0. PubMed . Identification of proteins associated with an IFNgamma-responsive...Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding.... doi: 10.1016/j.bbrc.2013.08.013. PubMed . Identification of telomere-associated molecules by engineered...

...antibodies. These monoclonal antibodies undergo application-specific validation and quality control by Addgene...all the antibodies currently available from our catalog. Addgene values transparency and accessibility ...antigen. Addgene supplies a list of recommended applications based on our in-house testing and data provided...with full experimental details in the Antibody Applications section of our product pages. We also include... an antibody’s use is not recommended for an application or species. We currently assess western blot,...scientists to further develop and refine these application lists. The plasmids we use to produce antibodies...intractable via animal immunization. Addgene's antibody catalog is a community resource that is growing! We welcome...

...the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 37825-AAV1....the material page (linked for each catalog ID below). Serotype Catalog ID Volume Price* AAV1 50465-AAV1....sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample is denoted...denoted with a .T suffix (for example, AAV1.T). The catalog ID for the 100 µL sized sample does not have the...from the CAG promoter. For information about each catalog item, including the titer and quality control, ... synpasin promoter. For information about each catalog item, including the titer and quality control, ...

...Marker PI Publication Bacteria Plasmid Gene/Insert Promoter Selectable Marker PI Publication Plant Plasmid... Marker PI Publication Yeast Plasmid Gene/Insert Promoter Selectable Marker PI Publication Zebrafish Plasmid...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...editors are created by fusing Cas9 nickase or catalytically inactive “dead” Cas9 (dCas9) to a cytidine deaminase...and are thus well suited to directed evolution applications. Examples of these base editing systems include...Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions for other plasmids that...

.... Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9 fused to a transcriptional...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...introduce a double-strand break (DSB) at a specific location based on a gRNA-defined target sequence. DSBs ...efficiency than NHEJ. Plasmid Gene/Insert Promoter PI Publication Nick CRISPR/Cas nickase mutants introduce gRNA-targeted...repair (HDR). Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused to a reverse...specific locus. Plasmid Gene/Insert Promoter PI Publication Empty gRNA Expression Vectors Select a gRNA expression...but their function is often limited to a single category (cut, nick, etc.) On the other hand, gRNA plasmids...

... the human brain through the development and application of innovative tools enabling large-scale real-time...or when BRAIN Initiative grants are noted in publications associated with Addgene materials. Plasmids ...Gradinaru 105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...108912-AAV9 pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3 Cation channelrhodopsin ChroME targeted to the neuronal.... Useful for nuclear isolation and scRNA-seq applications. Jonathan Ting 163909-AAV9 pAAV_hSynapsin_psychLight2...and AIS-localized genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector expressed...2P-WPRE Double floxed genetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector under ...

...: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic subunit gamma... below. Color is used for clarity and does not indicate a specific relationship. The content and map for...Research Color is used for clarity and does not indicate a specific relationship. The content and map for...Phosphatidylethanolamine binding protein 1 PIK3 Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl...PLXNB1 Plexin B1 PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5...

... the original publication below. You can also download the full-text of the publication here . Article...given the efficiency of biallelic modification, ease of rapid identification by PCR, predictability of loss-of-function... of Visualized Experiments (JoVE). The video publication by Stuart Orkin's and Daniel Bauer's labs details...addition, we describe techniques for deletion, identification, and characterization. This strategy relies...elements. For creating a gene knockout, two sgRNA located within exons will enrich even monoallelic deletion...Alternatively use another transfection method such as cationic liposome-based transfection. Optimize transfection...10.3791/52118 (2015). PubMed For the complete publication, including representative results and discussion...

...loci seem to be associated with the disease and implicate a wide range of cellular processes. The vast majority... consists mainly of managing symptoms through medication and surgery. PD primarily involves the malfunction...available from Addgene, sortable by type of genetic modification and target species. You can also find our guide...Sun et al. Nat Methods. 2020 Oct 21. Glutamate indicators with improved activation kinetics and localization...A multicolor atlas for whole-brain neuronal identification in C. elegans. Yemini et al. Cell. 2021 Jan...Alzforum is a news website and information resource dedicated to helping researchers accelerate discovery and...Banks Rodent Models Michael J Fox Foundation is dedicated to finding a cure for Parkinson's disease through...