...opto-chemogenetic actuator. When the luciferase enzyme oxidizes its substrate (luciferin), it generates light that...luminescent opsins: fusion proteins of a light-emitting luciferase and a light-sensing optogenetic element, making...

... enzyme with a short recognition sequence (like MluCI) that will cleave DNA frequently enough to result...

...PBAD), and the A118 gene downstream of the diacetylphloroglucinol (DAPG)-inducible promoter (PPhlF).  Output...

...18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression; also expresses luciferase Lowe 9044 pMIG...Sun 60683 pLXIN-Luc MoMSV Stable expression of luciferase in mammalian cells Wong Return to Top Do you ...

...PubMed Central PMCID: PMC1978145. 27. Greenough, Lucia, et al. "Adapting capillary gel electrophoresis ...

...stranded breaks (DSB) are lethal. Addgene depositor Luciano Marraffini’s lab took advantage of this lethality...

...Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40 CMV ffLuciferase Constitutive 8 Wilson 105536 ...

...backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression EFS AAV Zhang 60229 AAV...Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer 68448...12463 p231 pCMVe-betaAc-STOP-luc Cre dependent luciferase expression Mammalian Green 32145 pJFRC172-10XUAS-loxP...

...single copy in mammalian cells; Expresses firefly luciferase hairpin and GFP under pTREtight promoter None...pSBtet-GP Sleeping Beauty transposon system; has luciferase in cloning site; see article for additional selection...

...Scientists have been working at lightning speed to elucidate as much as they can about this novel virus. It...spike pseudotyped virus. It also lists several luciferase and fluorescent reporter plasmids that have been...

... Resources You May Also Like... Luminescence: Luciferase Plasmids Blog: Which FP Should I Use? Blog: How...

...Zinc Fingers Luminescence Fluorescent Proteins Luciferase Optogenetics Chemogenetics Viral Plasmids Lentivirus...

...Creating three-part fusion proteins - Planas and Santalucia Labs pCri System : Heterologous protein expression...

... Promoter Measure promoter strength pBV-Luc - Luciferase reporter plasmid with very low...

...as a safeguard against bacteriophages was not elucidated until 2007. Scientists hypothesized that prokaryotes...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin) is ...efficiencies. Depending on the type of luciferase used, the luciferin substrate may be the native coelenterazine...is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite or inhibit...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

... MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214673 lucMAPT-30U MAPT T5, luciferase CMV Parkinson's...FTD Eugene Yeo 214674 lucMAPT-GenRep MAPT T5, luciferase CMV Parkinson's, FTD Eugene Yeo 214814 U6_ ATM_G101...

...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

...AGACGACCCTGTCATCCGCA 74188 cut S. pyogenes 26627737 Moffat Luciferase ACAACTTTACCGACCGCGCC 74190 cut S. pyogenes 26627737...

...You may also like... Addgene Blog: Biosensors Luciferase Plasmids Subcellular Localization Optogenetics...