... Resource Center (EZRC) - A repository at the Karlsruhe Institute of Technology (KIT) for the distribution...

...the PAM sequence is immediately adjacent to the nearly-homologous target sites. The mere presence of additional...

...cells for mycoplasma (Link opens in a new window) regularly Do not over or under-grow your cells. Thaw a new...selection. It is important to monitor these cells regularly and replace the cell media. Cell death by some... or removed from the culture, check the cells regularly to confirm transgene expression. As polyclonal..., consider generating monoclonal lines from the early polyclonal populations. Sample Data Figure 1: Generation...

...properly maintain the water bath, empty and clean it regularly. Determine the amount of water needed to fill ...out after your incubation is over. Note: If you regularly use a water bath in the lab, you can leave the...previous uses. However, you will still need to regularly clean out the water bath even if you are using...

... of the BSL-2 area. BSL-2 laboratories must be clearly marked as “BSL-2.” The names and contact information...information of the laboratory manager should be clearly visible in the room and on the door. BSL-2 centrifugation...

...genome-containing virions. Phenol red is added to clearly distinguish the steps. This method will help enrich...gradient before ultracentrifugation. The steps are clearly distinguishable thanks to the use of phenol red...

...more quickly if you place the gel tray at 4 °C earlier so that it is already cold when the gel is poured...you get better separation of bands? If you have similarly sized bands that are running too close together...

... cloning is incredibly versatile and allows for nearly any piece of DNA to be placed into a backbone vector...complement to get PCR amplification. We can start similarly, taking the final 18bases of the ORF, including...

...monoclonal cell lines from the polyclonal pool as early as possible, though in theory a monoclonal line ...empirically, and that the cell population be monitored regularly for transgene expression. This protocol has been...

...because the early genes necessary for replication have been deleted from the shuttle vector. Early gene E1...erminal r epeats (ITRs). Genes are divided into early (E1-4) and late (L1-5) transcripts. There are 57...crossover event between your adenoviral vector and the early genes found in the packaging cell lines creates ...

...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT...CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT...primer pLTet-F ACTGAGCACATCAGCAGGAC Lambda phage early leftward (pL) promoter, forward primer pLXSN 5' ...pMRB101-F AAGATGCAGGCAGCTGAGTT HCMV major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT...

...Publications CRISPR Overview Class 2 C lustered R egularly I nterspaced S hort P alindromic R epeat (CRISPR...strand separation and cutting at off-target sites. Similarly, SpCas9-HF1 lowers off-target editing through ...target DNA based on the gRNA targeting sequence. Early experiments demonstrated that targeting dCas9 to...genetic screening. Forward genetic screens are particularly useful for studying diseases or phenotypes for...Cas12a (also known as Cpf1) CRISPR C lustered R egularly I nterspaced S hort P alindromic R epeat, a bacterial...2013. Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM. Science . 339(6121)...

...you get better separation of bands? If you have similarly sized bands that are running too close together...

...this simple digest less informative. This is particularly true if you receive a plasmid from someone in...

...single reaction Ligation Independent Cloning (LIC) Scarless cloning with Type II restriction enzymes and T4...

...cells for mycoplasma (Link opens in a new window) regularly Do not over- or under-grow your cells. Thaw a ...

...storing and replicating plasmids. Because of this, nearly all plasmids (even those designed for mammalian...

...the important regions of your final plasmid, particularly the seams between the assembled parts. Tips ...

...cells for mycoplasma (Link opens in a new window) regularly Do not over or under-grow your cells. Thaw a new...

...Introduction The pipette is an essential tool for nearly anyone in molecular biology. You’ll use a pipette...