... A., Chan, M. M., Bauer, D. E., Marson, A., Parsons, L. R., & Adamson, B. (2024). Improving prime editing...including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon systems...I., Yoon, Y., Song, C., Cao, Y., Gallant, J., Xue, W., Rivera-Pérez, J. A., & Sontheimer, E. J. (2019)...S., Cofsky, J. C., Kranzusch, P. J., Sontheimer, E. J., Davidson, A. R., Maxwell, K. L., & Doudna, J. ..., J., Edraki, A., Shah, M., Sontheimer, E. J., Maxwell, K. L., & Davidson, A. R. (2016). Naturally occurring... Chen, C., Nelson, J. W., Newby, G. A., Sahin, M., Osborn, M. J., Weissman, J. S., Adamson, B., & Liu,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti...

...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden ...Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc... AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato Flp dependent 8 Boyden 100049 pAAV.hSynap.ChETA...9 Deisseroth 105448 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Syn ChrimsonR (soma-targeted) mRuby2 Cre dependent...Adesnik 124603 pAAV-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-SV40 EF1a ChrimsonR (soma-targeted) mRuby2 Cre ...9 Adesnik 124651 pAAV-CamKIIa-ChrimsonR-mScarlet-KV2.1 CaMKII ChrimsonR (soma-targeted) mScarlet Constitutive... Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen...

..., 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 5, 8 Wilson 105532 pAAV.CMV.ffLuciferase.SV40...ffLuciferase Constitutive 8 Wilson 105536 pAAV.TBG.PI.Null.bGH TBG none Constitutive 8 Wilson 105541 pENN.AAV.CamKII0.4...Constitutive 1, 5 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP Constitutive 8 Wilson 105542 pENN.AAV.CB7..., 2, 5, 8, 9 Wilson 105543 pENN.AAV.cTNT.PI.eGFP.WPRE.rBG cTNT EGFP Constitutive 9 Wilson 105544 pENN...., PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 8 Wilson 105549 pAAV.GFAP.eGFP.WPRE.hGH...Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn TurboRFP Constitutive 1 Wilson 105556 pENN.AAV.tMCK.PI.eGFP.WPRE.bGH...Constitutive 9 Wilson 105557 pENN.AAV.CB7.CI.mCerulean.WPRE.RBG CB7 mCerulean Constitutive 1, 9 Wilson 105598 ...

...meningitidis Thomson pSmart-Nm-sgRNA-BbsI 49157 Mammalian U6 none N. meningitidis Thomson pXCas9H840A ...pyogenes Pederson pLH-nmsgRNA1.1 64115 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA1.1...meningitidis Pederson pLH-stsgRNA2.1 64117 Mammalian/Lentiviral U6 none N. meningitidis Pederson pLH-stsgRNA3.1... Herold lentiGuide-Crimson 70683 Mammalian/Lentiviral hU6 none S. pyogenes Crimson Bauer BPK2660 70709...pyogenes EGFP Jackson AIO-mCherry 74120 Mammalian U6x2 yes, nick S. pyogenes mCherry Jackson pMZ376 74213...Drosophila BbsI none S. pyogenes O'Connor-Giles, Harrison, Wildonger gRNA_Cloning Vector 41824 Mammalian...Worm BsaI none S. pyogenes Boxem pIK198 65629 Worm Gibson none S. pyogenes Katic pHKMC1: Empty sgRNA for ...

...Cre CMV AAV Wilson 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 EGFP-Cre fusion hSyn AAV Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40...EGFP-Cre fusion CMV AAV Wilson 105550 pAAV.GFAP.Cre.WPRE.hGH Cre GFAP AAV Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40...GFP-Cre fusion CamKII AAV Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Cre hSyn AAV Wilson 105555 pENN.AAV.hSyn.Cre.hGH...pENN.AAV.hSyn.Cre.hGH Cre hSyn AAV Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 Cre CamKII AAV Wilson 105603 pAAV.GfaABC1D.PI.Cre.SV40...Khakh 105869 pEMS1925 iCre-ERT2 Simpson 105870 pEMS1725 iCre-ERT2 Simpson 106368 pCMV-Tag2B-NCre N-terminal...AAV.TBG.PI.Cre.rBG Cre TBG AAV Wilson 107788 AAV.rTH.PI.Cre.SV40 Cre rTH AAV Wilson 108454 mCherry-p2A-CreERT2...recombination has occurred, allowing for direct comparison of Cre+ and Cre- cells. While Cre-lox recombination...

...CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII 0.4.Cre.SV40 CamKII none 1, 5, 9, rg* Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG...5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre..., rg*, PHPeB Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn none 1, 2, 5, 8, 9, rg* Wilson 105555 pENN.AAV.hSyn.Cre.hGH...105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson 196410 AAV-GfaABC1D-Cre-4x6T GfaABC1D none 5 Carmichael...Carmichael 107788 AAV.rTH.PI.Cre.SV40 rTH none 9, rg* Wilson 24593 AAV-pgk-Cre PGK none rg* Aebischer 51507 ....AAV.hSyn.Cre.hGH Syn none 9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato...PHPeB Larsen 107787 AAV.TBG.PI.Cre.rBGe TBG none 8 Wilson Light-Inducible Recombinases ID Name Promoter Fluorophore...

...23940360 Thomson OCT4 H. sapiens GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer...Guigo, Johnson GFPmut3b synthetic ACCATCTAATTCAACAAGAATT 73224 interfere S. pyogenes 26689101 Hudson xylR...ACCATCTAATTCAACAAGAATT 73221 interfere S. pyogenes 26689101 Hudson pgi C. glutamicum TGACCGATCATTACTCAAACTTCC 74066...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2...

...105448-AAV9 pAAV-hSyn-DIO-ChrimsonR-mRuby2-ST Cation channelrhodopsin ChrimsonR fused to mRuby2 fluorophore...pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST Cre dependent co-expression of jGCaMP8s and soma-targeted ChrimsonR under the ...pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE Expresses bicistronically soma-targeted ChrimsonR in frame...Chemogenetics Cre-dependent expression plasmid Scott Sternson 119741-AAV9 AAV SYN flex PSAM4 GlyR IRES EGFP ...Chemogenetics Cre-dependent expression plasmid Scott Sternson 119742-AAV5 AAV SYN PSAM4 GlyR IRES EGFP Chemogenetics...Chemogenetics expression plasmid Scott Sternson 119744-AAV5 AAV CAMKII PSAM4 GlyR IRES EGFP Chemogenetics...

...Hidalgo-Reyes Y, Lee J, Edraki A, Shah M, Sontheimer EJ, Maxwell KL, Davidson AR. 2016. Naturally occurring off-switches...MF, Hidalgo-Reyes Y, Wiedenheft B, Maxwell KL, Davidson AR. 2015. Multiple mechanisms for CRISPR-Cas inhibition...26416740 Bondy-Denomy J, Pawluk A, Maxwell KL, Davidson AR. 2013. Bacteriophage genes that inactivate ...132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes...Cell . 159(3):647-6. PMID: 25307932 Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-...Topkar VV, Nguyen NT, Zheng Z, Gonzales AP, Li Z, Peterson RT, Yeh JR, Aryee MJ, Joung JK. 2015. Engineered...Naseri A, Reyes-Gutierrez P, Wolfe SA, Zhang S, Pederson T. 2015. Multicolor CRISPR labeling of chromosomal...

...nerve cell function within the cell. Parkinson's Disease Parkinson’s disease (PD) is a chronic and progressive...neurodegenerative diseases include Alzheimer’s, Parkinson’s, ALS, and Huntington’s Disease. These diseases...as early-onset, where symptoms appear between a person’s thirties and mid-sixties, or late-onset, where...where symptoms appear during or after a person's mid-sixties. The early-onset form accounts for less than...created with support from the BRAIN Initiative. Jackson Laboratory (Link opens in a new window) A collection...A foundation dedicated to finding a cure for Parkinson's disease through an aggressively funded research... of improved therapies for those living with Parkinson's today. The Michael J. Fox Foundation has made...

...website. For a comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and...1998) References George N, Pick H, Vogel H, Johnsson N, Johnsson K. 2004. Specific labeling of cell surface...9712910 Vivero-Pol L, George N, Krumm H, Johnsson K, Johnsson N. 2005. Multicolor imaging of cell surface...

... and Cap7 Wilson 112864 pAAV2/8 AAV8 AAV packaging plasmid, expressing Rep2 and Cap8 Wilson 112865 pAAV2...not known to cause disease in humans. For these reasons, AAVs are generally contained at lower biosafety...packaging, expressing adenovirus E4, E2A and VA Wilson RepCap Plasmids for Serotypes Available as a Viral...AAV packaging plasmid, expressing Rep2 and Cap1 Wilson 104963 pAAV2/2 AAV2 AAV packaging plasmid, expressing...AAV packaging plasmid, expressing Rep2 and Cap9 Wilson 112866 pAAV2/rh10 AAVrh10 AAV packaging plasmid...plasmid, expressing Rep2, and rh10 capsid Wilson 81070 rAAV2-retro helper AAV retrograde AAV packaging plasmid...

...Recombinases Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn Cre expression Recombinases Wilson 105558 pENN.AAV.CamKII...105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control Wilson 24593 AAV-pgk-Cre PGK Cre expression Recombinases...pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn EGFP-tagged Cre expression Recombinases Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII...0.4.Cre.SV40 CamKII Cre expression Recombinases Wilson 107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression...AAV.rTH.PI.Cre.SV40 rTH Cre expression Recombinases Wilson 55634 pAAV-EF1a-mCherry-IRES-Flpo EF1a Flpo and...

...Luciferase complementation in plants. Bioluminescence Resonance Energy Transfer (BRET) CalFlux VNT : An intracellular...co-expressed with mScarlet-I for ratiometric imaging David Nelson 141301 pRATIO1267 RedLuc/Gaussia Creation of C-...Gaussia luciferase for ratiometric imaging David Nelson 212935 pGL4.84(hRlucCP/Puro) RapidResponse(TM) ... expression of firefly luciferase and GFP James Wilson 22522 phGluc Gaussia EF1α Expression of Gaussia... CMV AAV expression of firefly luciferase James Wilson 101156 T7-CMVtrans-FFLuc-polyA Firefly T7 Expression... expression of firefly luciferase and GFP James Wilson 106457 pCR3.1-Luc Firefly CMV Mammalian expression...

...using sonication to break DNA up into fragments of 300-1000 bps in length. Note: This sonication process...may need additional processing steps, such as sonication. Denature proteins, using heat and/or chemicals...housekeeping genes). This allows for relative comparison of expression between different samples, by normalizing...normalizing protein expression to the controls before comparison. Alternatively, the samples can be normalized...ChIP protocols use enzyme digestion instead of sonication. This approach is gentler but results in non-...isolated and analyzed. Validation relies on size comparison of peptides. Independent antibody validation ...

...Structure Plasmids mCrimson3 588 615 - Monomer mCrimson3-N1 - Mammalian Expression mCrimson3-C1 - Mammalian...FRET Biosensors Subcellular localization Michael Davidson Collection Blog: Which FP Should I Use? Blog: ...Includes tagging with mCherry, mCitrine, mCerulean Davidson Lab Plasmids - Includes many N- and C-terminal... GFP - C-terminal GFP for bacterial expression Davidson Lab Plasmids - Includes many fluorescent proteins...

...Link opens in a new window) PMID: 17289941 2010 - Allyson Muotri's lab develops the first iPSC model for ...window) PMID: 26944080 (Link opens in a new window) Alysson Muotri Q83X C247T Q83X M Fibroblasts & iPSC (Link...window) PMID: 26944080 (Link opens in a new window) Alysson Muotri c.806delG 806delG G269Afs*20 M Fibroblasts...patient-derived iPSCs (Link opens in a new window) Jackson Labs - mouse line developer and repository, and...Pediatr Neurol . 52, 585-591.e2. PMID: 25801175 Tillotson and Bird. 2019. The Molecular Basis of MeCP2 Function...

... Collections MJFF Parkinson's Plasmid Resource Michael J. Fox Foundation Parkinson's Disease Plasmid Resource...Browse plasmids expressing genes relevant to Parkinson's disease created by the Michael J. Fox Foundation... researchers to assemble and share tools for Parkinson's Disease research. This collection is part of ...

...synthetase M. maripaludis phosphoserine Bacterial Jason W Chin 174078 pDule-3-nitroTyrosine (A7) 3NY (A7...MmPylRS_MmtRNA-Pyl-opt(UGA) PylRS M. mazei Bacterial TGA Jason W Chin 174516 pMB1_1R26PylRS(CbzK)_AfTyrRS(p-I-Phe... AfTyrRS CbzK and p-I-Phe Bacterial TCG and TAG Jason W Chin 174718 pRSF-G1mCNPRS G1mCNPRS M. archaeon...coumarin-yl) ethylglycine Bacterial TAG Kenneth Johnson 198323 pRSF-G1TMSNKRS M. archaeon TMSNK Bacterial..., TCA, or TAG codons in all open reading frames Jason W Chin 174514 Syn61Δ3(ev5) No TCG, TCA, or TAG codons... codons. Deletion of serT, serU, and prfA genes Jason W Chin 189857 Syn61Δ3(ev5) ΔrecA (ev1) No TCG, TCA...

...Total gRNAs Adamson DNA Repair CRISPRi Libraries 177663, 177664, 177670 Inhibition Human Adamson 3rd ∼3 366... 131625 Inhibition E. coli Bikard N/A ∼5 21,417 Bison sgRNA Library 169942 Knockout Human Ebert 3rd 4 ...Tan 2nd 4 on average 94,000 Bradley Human CRISPR Poison Exon Knockout Library 138084 Knockout Human Bradley... 227707 227708 Prime Editing Human Human Mouse Adamson 3rd 1-20 per edit Varies CRASP-Seq Gene KO Library...