... 5’ and 3’ homology arm repair template (Fig. 1, Step 1). There is no need for PCR or cloning, as digestion...selectable marker, and connector to be released (Fig. 1, Step 2-3). Since donor plasmids of the same type ...correctly assembles the final targeting vector (Fig. 1, Step 4), and co-injection of the targeting vector...human cells. To use CRISPaint, users need 3 vectors:  1) a gRNA vector that targets the gene of interest, ... Tagging with Short Homology Donors.” Cell Rep.15(1) (2016):210-8. PubMed PMID: 27052166. Kunzelmann,.... They can also be introduced directly into a Drosophila S2 cell line stably expressing Cas9. This PCR...Comprehensive Toolbox for Genome Editing in Cultured Drosophila melanogaster Cells.” G3 (Bethesda) 6(6) (2016...

...protocols. A typical ExM protocol (Fig. 1) follows this structure: Step 1: fix (and maybe label) your sample...microscopy. Nat Biotechnol 1–12. https://doi.org/10.1038/s41587-022-01546-1  Mikhaylova M, Cloin BMC, ...just adding water.)  Step 5: Image   Figure 1: The ExM process allows you to physically magnify ...16:71–74. https://doi.org/10.1038/s41592-018-0238-1  Klimas A, Gallagher BR, Wijesekara P, et al (2023...microscopy: a brief history and new avenues. Philosophical Transactions Royal Soc 380:20210110. https:/...

...gene expression and clonal analysis in Drosophila.” Nat Methods 9(1) (2011): 47-55. PubMed PMID: 22205518...Expression System for Drosophila. Methods Mol Biol. 2016;1478:53-78. doi: 10.1007/978-1-4939-6371-3_3. PMID...Bacillus. Appl Microbiol Biotechnol. 2019 Jan;103(1):303-313. doi: 10.1007/s00253-018-9485-4. Epub 2018... and lac promoters.” Proc Natl Acad Sci U S A. 80(1) (1983): 21-5. PubMed PMID: 6337371. PubMed Central...implemented in a variety of other organisms, such as sphingomonads and bacillus.  ADH1 The ADH1 negative repressible...culture. Repressible Binary Systems GAL4/UAS In Drosophila or development studies, you may hear some transcription... GAL80 under different promoters and create sophisticated patterns of UAS-driven gene expression. To further...

...one of three different inherited genes: Presenilin 1, Presenilin 2, and APP gene.The majority (>90%) of...collections available at Addgene. Amyotrophic Lateral Sclerosis Amyotrophic lateral sclerosis (ALS), sometimes...

... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter... primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward...primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F...

...infection, gene targeting vectors with relatively short (1 kb) homology arms underwent homologous recombination...sequences of interest to cells with efficiencies of 1-40% after G418 selection (Kohli et al 2004, Kim et...with polylinkers for the addition of gene-specific 1 kb homology arms flanking a FLOXed neoR gene. pAAV-SEPT-Acceptor...since it routinely generates knockin efficiencies of 1-40% with G418-selected clones. However, there are ...efficiency of gene editing is occasionally less than 1%, and virtually never exceeds 40%. While this is comparable...gene inactivation in human cancer.     References 1. Russell, David W., and Roll K. Hirata. "Human gene...zygotes and thereby correct a mutation that causes Hemophilia B. Unfortunately, work combining CRISPR with ...

...annealing temperature step-wise by 1-2°C. The rate of DNA synthesis is ~1-2 kb/min. The extension time can...now bind to the primer DNA sequence. Extend DNA for 1 minute at 72°C: The Taq polymerase has an optimal ...DNA (10 ng-500 ng) 5 μl 10X Taq buffer with MgCl 2 1 μl dNTP mix (10 mM each nt) 2.5 μL Forward Primer ...primer melting temperature (Tm). Set extension step at 1-2 minutes per kilobase of product depending on whether...working concentration of each primer (10uM) by making a 1:10 dilution of the stock. For example, add 100µl of... of a heat resistant DNA polymerase from the thermophilic bacterium, Thermus aquaticus (Taq) . Taq polymerase...

...incorporates several common genetic tools in Drosophila (Fig. 1):  GAL4-UAS, a transcription factor binding...Rodríguez et al., 2011).  Genetics of SPARC Figure 1: SPARC and SPARC2 use the GAL4-UAS system along with.... So far, tools to overcome this challenge in Drosophila require heat-shocking the system or using chemical...techniques to reliably label any post-mitotic cells in Drosophila. SPARC was developed by Thomas Clandinin’s lab...recombination sites. These sites are target sequences of PhiC31. In the SPARC system, attP sites are located on...is not expressed and the cells are not labeled. PhiC31, a recombinase. It specifically integrates an attP...attP site into an attB site. In the SPARC system, PhiC31 irreversibly recombines one of the two competing...

...a rate of up to 1 per 500-1000 bp. In comparison, the DNA replication error rate is 1 per 109 bp. Unlike...Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library of approved drugs against the entire kit; ...generated 5 common 30bp overlap sequences (Sites #1-5). Each overlap site encodes a unique restriction...First, GMAP-compatible backbones for lentivirus LV 1-5 and retrovirus RV 2-5 were constructed. The authors...is multiplex automated genome engineering (MAGE) (1). MAGE uses recombineering (2) to simultaneously incorporate...of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The key to the biosensor lies in pH: DsRed is relatively...inactivate SEP and leave only DsRed to fluoresce (1). With variants that can be targeted to specific cellular...

...production of the pro-inflammatory cytokine interleukin IL-1 beta in the dorsal raphe nucleus (DRN), a region thought... a transgenic mouse harbouring a Cre-dependent IL-1 beta overexpression cassette. Expression of Cre in...in these neurons turns on overexpression of IL-1 beta. They tested the mice in a series of behavioral ...risky), or a closed arm (safe). Mice with higher IL-1 beta production spent more time in the open arm and... part of the apparatus, it turned out that the IL-1 beta overexpressing mice spent more time in the risky... addiction. When an animal has been exposed to morphine or other stimulating drugs, it develops an enhanced... such genetic study focuses on brain derived neurotrophic factor (BDNF). BDNF is a small protein involved...

... chromosome, start, and stop. For instance (chr3, 1, 10) indicates a stretch of DNA at the very beginning...genetic elements like protein, RNA, and DNA (Table 1). As with GPS in the real world, coordinates alone...genomic coordinates into meaningful experiments. Table 1: An emerging family of "GPS for the genome" techniques...enhancers with the help of genome math. Figure 1: Genome math illustrated. Intersect (left) and set...histones with “GPS for proteins,” ChIP-seq from Table 1. Because of DNA’s 3D geometry and the chemical properties...experiment to identify the critical NANOG binding sites: 1. Find Enhancers that have NANOG binding sites 2. Design... In order to denote the NANOG enhancers from step 1 with genome math, we’ll need a bit of shorthand from...

...but also others including pseudorabies virus type 1, vesicular stomatitis virus (VSV; Beier et al., 2011...Skeletal Muscle AAV1, AAV6, AAV7, AAV8, AAV9 Table 1: Common AAV Serotypes and their target tissues (adapted... serotypes capable of entering neurons (see table 1)(Choi et al., 2005; Taymans et al., 2007; Howard et...efficiency, tropism and axonal transport of AAV serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain. PLoS One 8:e76310...Wolfe, J.H. (2014). Adeno-associated virus serotypes 1, 8 and 9 share conserved mechanisms for anterograde...,9 in rat neurons and glia in vitro. Virology 372(1), 24–34. PubMed PMID: 18035387. PubMed Central PMCID...transduction efficiency of recombinant AAV serotypes 1, 2, 5 and 8 in the rat nigrostriatal system. J Neurochem...

...was around 33% of that observed between Jan. 1 and Mar. 1, 2020. Figure 2: A simple approximation...paper. Green and red lines depict the sum of mean +1 and -1 std for each paper, respectively. The fitted...complication in the China data – there is a period of 1 month, from 1/22/20–2/23/20, where there were zero plasmid... from 5/22/14 to 5/19/20). Each paper has between 1–32 plasmids and a total of 2–2,590 requests. We received...correspond to publications of popular papers. Figure 1: Plasmid requests by date. Parentheses depict the ...China. However, it is evident that if we believe that 1/22/20–2/23/20 are the more accurate dates of lockdown...effect on plasmid requests Before we began any sophisticated analyses, we first visualized our data in various...

...difficult-to-manipulate primary cells, achieving knockdown within 1-2 hr of reagent delivery. TRIM-Away is suitable for... inducer levels. That is, if transcription factor 1 controls expression of transcription factor 2, which...modulating the induction of transcription factors 1 and 2. See Aranda-Díaz et al. for more information... from his recent Nature Communications article “SRpHi ratiometric pH biosensors for super-resolution microscopy... designed their super-resolution pH indicators (SRpHi) biosensors to meet all of them. These probes had...contributed a relevant post to the Addgene blog. Find the SRpHi Biosensors here. Richardson et al. Nat Communications...

...within the mitochondrial matrix.     Figure 1: A chart with MoClo kit recommendations for different...Traditional Biology.” ACS Synthetic Biology, vol. 5, no. 1, American Chemical Society (ACS), 4 Nov. 2015, pp...., vol. 4, no. 9, American Chemical Society (ACS), 1 May 2015, pp. 975–86. Crossref, https://doi.org/10.1021...Yeast Mitochondria.” BMC Biotechnology, vol. 17, no. 1, Springer Science and Business Media LLC, 13 Nov. ...Editing in Plants.” BMC Plant Biology, vol. 20, no. 1, Springer Science and Business Media LLC, 23 Apr. ...Arabidopsis Mutants.” The Plant Journal, vol. 106, no. 1, Wiley, 25 Mar. 2021, pp. 8–22. Crossref, https://...Cloning Platform.” Scientific Reports, vol. 9, no. 1, Springer Science and Business Media LLC, 12 July ...

...aggregation, and potentiates the effect of PD-1 blockade.“ (Ref 4). PD-1 helps tumor cells evade the immune system...fasting has a positive effect on cancer treatment (Ref 1). As described in the presentation, starvation or ...of the immunosuppressive cell surface receptor PD-1. This immunosuppressive environment in turn may represent...  (Chimeric Antigen Receptors) CAR T cells and PD-1 modulators. An exciting development in immunotherapy...free deposit and distribution service! References: 1. Pietrocola, Federico, et al. "Caloric restriction...Immunosurveillance and Defense With increasingly sophisticated visualization techniques it is possible to follow...

...effective recovery of knock-ins, but did result in 1-2 kilobases of additional sequence being introduced...facilitating recovery of edited animals. Figure 1: In the background are 504 restriction digests of ...selection for repair of a temperature-sensitive pha-1 mutation significantly enriches for knock-in of 2x... 3xFLAG epitopes into other, non-linked loci; pha-1(e2123) mutant worms are perfectly viable at 15 ºC,... repair pathway. Reagents required to perform pha-1 co-conversion are available through Addgene. In 2019...increases knock-in efficiency. Finally, as shown in Drosophila S2 cells (Böttcher et al., 2014), inactivation... Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K (2014...

...HIV-1 were transduced with a lentiviral vector containing an antisense sequence against the HIV-1 envelope... in the brain (Figure 1). 2nd generation lentiviral packaging system The graphic below shows how the lentiviral...Trono and collaborators turned to the lentivirus HIV-1, well-known to infect non-dividing cells. The first...plasmids. The packaging plasmid carried a mutated HIV-1 provirus that couldn’t package itself due to a few...plasmid encoded the desired transgene flanked by HIV-1 long terminal repeats (LTRs) that facilitate viral...infectivity, is often used as a substitute for HIV-1 Env, which can only infect CD4+ cells. 3rd generation...lentivirus in the comments section below! References 1. In vivo gene delivery and stable transduction of ...

...and Therapeutic Purposes. Annu Rev Virol. 2014 Nov;1(1):427-51. DOI: 10.1146/annurev-virology-031413-085355...personalized medicine. References and further reading 1. FDA approves gene therapy for blindness 2. Gene Therapy... Med Biol. 2014; 801: 687–693.  doi:  10.1007/978-1-4614-3209-8_86. PubMed PMID: 24664759. PubMed Central...prevalent or life-threatening (cystic fibrosis, hemophilia, muscular dystrophy)? AAV gene therapy started...trials for devastating genetic diseases such as hemophilia, muscular dystrophy, spinal muscular atrophy,...

... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...