...Biosensor Looger New serotype pAAV-CAG-DIO-NLS-mRuby3-IRES-eGtACR1-ST AAV9 Optogenetics Adesnik New viral vector...

...experiment. Select Your Desired Genetic Manipulation Different genetic manipulations require different CRISPR...will not contain the desired edit, as a large percentage of DSBs are still repaired by NHEJ. How do you...contain your desired edit, including but not limited to: Mismatch-cleavage assay (for NHEJ repaired DSBs): ...targeting the region where the edit should be made HDR requires a repair template and displays reduced efficiency... sequence be very close to the location of the desired edit, ideally less than 10 bp away. In this case...PAM sequences for your chosen enzyme within your desired sequence, you may want to consider alternative ...consider factors that maximize cleavage of the desired target sequence or on-target activity . Two gRNA...

...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...technique creates diverse populations of mutants for directed evolution. ID Plasmid Gene/Insert Promoter Selectable...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...

...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

...Alias: CN4361) Expression of jGCaMP8s in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4360) Expression of jGCaMP8s in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...: CN4035) Expression of CoChR-EGFP in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway medium spiny neurons (D1 MSNs) Jonathan...Alias: CN3987) Expression of jRGECO1a in striatal indirect pathway medium spiny neurons (D2 MSNs) Jonathan...AAV for Cre recombinase expression in striatal indirect pathway D2-MSNs Jonathan Ting Viviana Gradinaru... AAV for Cre recombinase expression in striatal direct pathway D1-MSNs Jonathan Ting Viviana Gradinaru...

... 105829 pIRE4-Azi Azi-tRNA synthetase (EAziRS) p-Azido-phenylalanine (Azi) Mammalian TAG Irene Coin 105830...biologists have expanded the genetic code by redirecting specific codons to encode amino acids beyond ...E.coli and can be mutated and screened through directed evolution to charge the tRNA with a different ...-like click amino acids, tRNA M15 Mammalian TAG Irene Coin 113644 pRF0G-Tyr tyrosyl-tRNA synthetase M....182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA.... Expresses yeast TrpRS/tRNA pair instead. For directed evolution of the liberated EcTrpRS/tRNA pair to...

...doi.org/10.1128/jvi.71.8.6174-6178.1997 Wickersham IR, Finke S, Conzelmann K-K, Callaway EM (2006) Retrograde...–49 . https://doi.org/10.1038/nmeth999 Wickersham IR, Lyon DC, Barnard RJO, Mori T, Finke S, Conzelmann...Infection of these cells with VSV-G pseudotyped virus requires the upregulation of LDLR expression using other...neurons. However, VSV-G’s broad tropism can be undesired for in vivo studies since there’s the potential...neuronal cells and can travel in a retrograde direction from the synapse to the cell body, making it a...use rabies virus is to delete the glycoprotein required for entry into the cell (rabies dG). Because rabies... system (Wickersham et al., 2007). This system requires first supplying rabies glycoprotein along with...

...contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA would bind. (5) After the...double-strand break (DSB) induced by Cas9 could be repaired through non-homologous end joining (NHEJ) , an...homology arms was supplied, the break could be repaired according to this template, allowing for precise...tags, or loxP/FRT sites, among others. Homology-directed repair (HDR) allows us to create a variety of ...occurred at a truly astonishing pace, with work directed towards increasing on-target editing rates and...cuts only one strand of DNA and can be used with paired gRNAs to lower off-target cleavage frequency. Truncated...rely on NHEJ or HDR: Base editors : Base editors directly convert bases without creating a double-strand...

...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

...25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA 71479 cut VQR Cas9 variant 26680661 Fire dpy‐10 C....25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974...pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT 60212 cut S. pyogenes 25161212 Fire sv40 promoter...CGCTACCATAGGCACCACG 71516 cut VRER Cas9 mutant 26680661 Fire dpy-10 C.elegans GCTACCATAGGCACCACGAG 65630 cut ...GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 Fire rgs4 D. rerio GGAGAAGGTGAAGGACACTG 42246 cut S. ...GTGAGACGTCAACAATATGG 59930 cut S. pyogenes 25161212 Fire Rosa26 M.musculus ACTCCAGTCTTTCTAGAAGA 64216 cut...GGAACTCGTGTCAAAACAAC 59932 cut S. pyogenes 25161212 Fire unc-119 C. elegans GAATTTTCTGAAATTAAAGA 46169 cut...

...genome directs the production of more viruses. However, in theory, a viral genome could direct the host... of their mild immunogencity. These viruses can direct long-term transgene expression, but generally are...Adenoviruses have high transduction efficiency and direct high but transient transgene expression. γ-Retrovirus...molecules or to express other genes. Viruses used to direct these alternate functions simply have to harbor...array of viral genomes, enabling researchers to direct a wide array of genetic functions in cells. For... through the removal of certain genes that are required for viral replication. Thus, as a safety feature...occurring viruses do. Instead, the genes that are required for viral replication are usually divided among...

...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Gene/Insert Promoter ...a prime editing guide RNA (pegRNA). The pegRNA directs the nickase to the target site by homology to a...locus and encodes a primer binding site and the desired edits on an RT template. ID Plasmid Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions...

...Monitoring the action of redox-directed cancer therapeutics using a human peroxiredoxin-2-based probe. Nat Commun... with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with peroxiredoxin-based...diacylglycerol and STIM1 signalling system regulates directed cell migration. Nat Cell Biol. 2014 Feb;16(2):...cellular locations. PLoS One. 2012;7(11):e49371. Direct comparison of a genetically encoded sensor and ...11/520/eaah3738. Justin Blau cAMP (cyclic AMP) cAMPFIRE cAMP biosensors with improved sensitivity Sensitive... PLoS One. 2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron...mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors...

...gRNA-defined target sequence. DSBs are preferentially repaired in the cell by non-homologous end joining (NHEJ...present, the cell may repair a DSB using homology-directed repair (HDR) instead of NHEJ. In most experimental...nicks create a double-strand break (DSB) that is repaired using error-prone non-homologous end joining (...template to introduce specific edits via homology-directed repair (HDR). ID Plasmid Description Gene/Insert...of a specific gene. Design your gRNA sequence to direct the dCas9-activator to promoter or regulatory regions... FLAG-tagged Cas9. Design your gRNA sequence to direct dCas9 to a specific locus, avoiding known transcription...plasmids that do not co-express a Cas protein can be paired with a wide variety of Cas-containing plasmids....

...interest and effort directed toward expanding this capacity. Traditionally, AAV requires the presence of ... products that mediate AAV replication. This requirement has been circumvented with “helper-virus free...., 1998). It lacks adenovirus helper functions required for stock production. Russell 127848 pUCmini-iCAP-PHP.V2...cap plasmid. Capsid is mouse brain tropic AAV-F Maguire 170716 Olig001 Olig001 Olig001 encodes a novel ...smooth muscle cells in mice after systemic delivery Maguire 198014 pCMV-AAV2cap AAV2 For high-level expression...(which may not be available at Addgene) may be required to produce infectious AAV particles. You can search...

...promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT 3' end of IRES, forward primer IRES-R CCTCACATTGCCAAAAGACG...CCTCACATTGCCAAAAGACG 5' end of IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector...

...Wormbuilder website. General Tools Fire Lab C. elegans Vector Kit - Andrew Fire Lab. A set of vectors for C....characterized which allow researchers to express desired constructs in precise cell types and/or developmental...plasmids that can be used in worms, search Addgene's entire collection. ID Plasmid Description Gene/Insert ...modified approach has also been developed by the Fire laboratory and described in Efficient Marker-Free...vectors. C. elegans optimized fluorophores - Andrew Fire Lab. Available with and without PATC, which diminishes...

...and homologous directed repair (HDR) frequency. CRISPResso requires two inputs: paired-end reads (two ...amplicon deep sequencing, WGS datasets and allows the direct comparison of individual experiments. PubMed PMID...potential DNA target sites for TALEs and CRISPR/Cas. CRISPRdirect From the Database Center for Life Science (DBCLS...Feng Zhang lab: Tips for CRISPR design, homology directed repair and cloning . CRISPR Discussion Group (...

...off-target alterations and require only a single gRNA. Cas3 must be paired with the Cascade ( C RISPR-...can continue for many kilobases in one or both directions from the target region, effectively turning Cas3... Cas5, Cas6, Cas7, Cas8, and Cas11. Cascade is directed to target DNA using a gRNA and recruits Cas3. ...other proteins bound to DNA, and the break can be repaired by the cell’s endogenous repair mechanisms. Cas3...

...bacterial genome itself. Manipulating the genome directly can give you more subtle control over protein ...thereby limiting the use of cellular resources required for the production of large amounts of protein...studying the basic biology of a bacterial gene or redirecting metabolic pathways to produce a therapeutic compound...Transposition is efficient enough that selection is not required. pET-HIS-Sangamo 40786 TALEN Gang Bao Gateway ...expression of a recombinant protein with a 6x His tag. Requires a strain with T7 RNA polymerase. Amp resistant...expression from that element. When this activation requires a transcription factor to bind to a small molecule...