...phosphatase-positive assay) as well as stabilization (Nanog-GFP reporter activation and silencing of factor-linked mCherry...elements and combined it with a variety of reporters (i.e. eGFP) and effectors (i.e. DREADDs). The team ...are available at Addgene. Kim, et al. Stem Cell Reports. 2015. PubMed PMID: 25772473 Targeting and manipulating...quantum yield of 0.54) and mScarlet-H with M164H (2-fold improvement in photostability compared to mScarlet...off-target cutting, and they found that HF-BE3 showed 37-fold less off-target editing than BE3, with only a slight...reagents shared via Addgene. Narayan S, et al. Cell Reports. 2017. PubMed PMID: 28813671 Listen to the podcast...along with EGFP while retaining an emission spectrum that is easily separable from that of EGFP. This makes...

..., Bernach plans to use a suite of fluorescent reporters. Bacteria containing unstable fluorescent proteins...colonizer, labelled with a constitutively fluorescent reporter can also be used to track how one population responds...using TIMER and an unstable fluorescent protein reporter under the control of promoters that control cell...fluorescent protein topics page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org... the TIMER growth rate bioreporter. During protein maturation, the bioreporter spontaneously changes from...decreased in protein abundance, possibly due to misfolding. But measuring variants one at a time is time...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...

...of posts explains how to critically assess the reported properties of fluorescent proteins, how to do ...protein with a high intrinsic brightness that does not fold well or cannot be detected in a microscopy setup...experimental conditions into account. In particular, the folding and maturation efficiency of the fluorescent protein... QY (EC*QY, sometimes normalized to the value of EGFP). The higher the number, the higher the theoretical...

... strain transformed with pBLADE expressing superfolder GFP instead of mCherry under the PBAD promoter....the DNA-binding domain of AraC using a mCherry reporter downstream of a PBAD promoter. While none of the...contains BLADE, the PBAD promoter, and a mCherry reporter downstream of the PBAD promoter. To use this plasmid...

..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They...-ome using a quick, affordable, and ubiquitous reporter assay. In their recent publication, Kroeze et ...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ... different human cell models and identified ~4-5-fold more fitness-related genes than have been found ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...when it is difficult for a cell to synthesize or fold a protein because of its length. Mark Howarth’s ...endogenous proteins. As described in their recent Cell Reports paper, the Kanemaki lab overcame this hurdle using...

...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...facilitates CRISPR/Cas9-based genome editing. Scientific Reports . 5 , 11315. PMID: 26066060 Zuris, J. A., Thompson...and inserted into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However...

... using a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate...of interest and an inactivated fluorescent RNA reporter. If the target sequence is present in the pool...activity of Cas13a becomes activated and the RNA reporter will be cleaved resulting in activation of the...

...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...plasmids, which contain various promoters and reporters, and subsequently inserted into a Cas9-containing...-in-one CRISPR/Cas9 vector system.” Scientific Reports 4 (2014): 5400. PubMed PMID: 24954249. PubMed Central...vectors containing the U6 promoter and the gRNA scaffold are provided with the kit. Oligonucleotides specifying...

... S A. 2023 Aug 22. Use a lentiviral FRET-based reporter to study tau seeding in mammalian cells. Lathuiliere...Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature. 2014 Apr 17. ... (AIS) plasticity with a motor neuron-specific reporter and a PAX7 inducible vector . Harley et al. Cell.... These glutamine-rich sequences are prone to misfolding and aggregation and can interfere with protein-protein...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... pyogenes 23929339 Sheen pGL3-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...

...is typically used for gRNA May contain reporter gene (e.g. GFP) to identify and enrich positive cells,... separate transfer vectors May contain reporter gene (e.g. GFP) or selection marker to identify and enrich...facilitates CRISPR/Cas9-based genome editing. Scientific Reports . 5 , 11315. PMID: 26066060 Zuris, J. A., Thompson...and inserted into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However...

...and a ssDNA-fluorescently quenched reporter is added. As this reporter is degraded by Cas12a, it will release... using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to the reaction...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence... target sequence, it promiscuously cleaves the reporter as well, and a quantifiable signal is produced...all-in-one CRISPR/Cas9 vector system. Scientific Reports , 4 (1). PMID: 24954249 Shechner, D. M., Hacisuleyman...mapping multiprotein complexes in human cells. Cell Reports . 13 (3), 621–633. PMID: 26456817 Doench, J. G....The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-...

....1 showed the greatest fold change in RNA and DNA levels (~25-fold and ~4-fold respectively) relative ...expression from mouse to primate neocortex. Cell Reports, 34(13). https://doi.org/10.1016/j.celrep.2021.108754...relatively even distribution of target gene expression (EGFP, in the depositing manuscript) across the brain....

...optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium indicators...plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk...photoswitch. Illumination causes the photoswitch to unfold, lowering the toxin's local concentration near ...

...and a ssDNA-fluorescently quenched reporter is added. As this reporter is degraded by Cas12a, it will release... using a fluorescent reporter. In SHERLOCK, a quenched ssRNA fluorescent reporter is added to the reaction...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence... target sequence, it promiscuously cleaves the reporter as well, and a quantifiable signal is produced...all-in-one CRISPR/Cas9 vector system. Scientific Reports , 4 (1). PMID: 24954249 Shechner, D. M., Hacisuleyman...mapping multiprotein complexes in human cells. Cell Reports . 13 (3), 621–633. PMID: 26456817 Doench, J. G....The gRNA is a short synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-...