...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...

...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha...

...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For...122650 Mm-PylRS-AF/Pyl-tRNACUA PylRS M. mazei trans-cyclooct- 2-ene-lysine (TCOK) Mammalian TAG Howard Hang...

...Expression mEGFP 488 507 34 6 Monomer (A206K) pmEGFP-1 - Mammalian Expression mEGFP-N1 - Mammalian Expression...TurboRFP-pBAD - Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...-pBAD - Bacterial Expression mRFP1 584 607 13 4.5 1 hr Monomer pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1... of Biomedical Optics, Feburary 2005, Vol. 10 No. 1, p. 14003 Chu et al. : Nature Methods, May 2014 Vol...pp. 7913–7923 Hoi et al. : Chemistry & Biology, October 2013, Vol. 20 No. 10, pp.1296-304 Kogure et al....

...are based on the Epstein-Barr Nuclear Antigen-1 (oriP-EBNA-1) system where each vector contains a viral ...replication, OriP and the EBNA-1 sequence that encodes for the DNA binding protein EBNA-1 [7]. These two sequences...extra plasmid, pCXWB-EBNA-1 is used in the reprogramming cocktail. pCXWB-EBNA-1 lacks oriP and is unable...expressing additional EBNA-1 transiently. The transiently expressed EBNA-1 increases protein expression...pCXLE vectors listed below in Table 1 are available at Addgene. Table 1: List of pCXLE episomal plasmids,... pCXLE-hOCT3/4-shp53-F 27077 OCT3/4 and shRNA against p53 pCXWB-EBNA1 37624 transient EBNA-1   Many...expression of the reprogramming factors- OCT3/4, SOX2, KLF4, and C-MYC [1]. For the derivation of clinical grade...

...) element and the cis-acting EBNA-1 from Epstein-Barr virus. EBNA-1 binds oriP and allows for replication...Difficult to purify reprogramming proteins. Table 1: Key Features of Different Methods for Generating ...-based expression requires serial transfection of 1 or 2 plasmids that express the reprogramming factors...  Replicating oriP/Epstein-Barr nuclear antigen-1 (EBNA1) based episomes: These plasmids carry the origin...method Most iPSC research falls into two categories: 1) studies focused on better understanding the mechanisms...iPSCs experiences in the comments below! References  1. Sano, Masayuki, Minoru Iijima, Manami Ohtaka, and...Methods figures were adapted from this reference. 1. Malik, Nasir, and Mahendra S. Rao. "A Review of the...

... Figure 1 below) was free to anneal to complementary ssDNA molecules in vitro. Figure 1: Cas9 binding...allowed sequence replacement rates of approximately 1%. This is by no means a large number, but it was attained...who worked on this publication:         References 1. Richardson, Christopher D., et al. "Enhancing homology-directed...contributed by guest blogger Chris Richardson, a Postdoctoral Researcher in Jacob Corn’s lab. CRISPR-Cas9 ... optional donor DNA. Chris Richardson is a Postdoctoral Researcher in Jacob Corn’s lab investigating...

...into more specialized cells with specific functions [1]. In many tissues, stem cells serve to replenish/replace...damaged cells that no longer function adequately [1]. Stem cells’ ability to differentiate into multiple...://www.linkedin.com/in/kmukherjeephd/. References 1. Dittrich, R., M.W. Beckmann, and W. Wurfel, Non-embryo-destructive...The potential of muscle stem cells. Dev Cell, 2001. 1(3): p. 333-42. PubMed PMID: 11702945. 6. Cowan, C....preimplantation genetic diagnosis. Hum Reprod, 2008. 23(1): p. 46-53. PubMed PMID: 17989069. 8. Takahashi, K... the ectopic expression of four embryonic genes- OCT4, SOX2, KLF4, and C-MYC. iPSCs were first generated...communication and publishing after completing her postdoctoral training from Massachusetts General Hospital...

...cellular proteins are modified through phosphorylation (1). However, the expansion of studies on protein phosphorylation...three components required for translation (Figure 1): A tRNA that recognizes a specific ‘open’ codon ... open reading frame (ORF) of interest (Figure 2). 1. The phosphoserine OTS The backbone of the phosphoserine...modification allowed the deletion of release factor 1, the protein responsible for terminating translation...Rinehart lab: pCRT7 NT TOPO E17TAG GFP and pGEX-6P-1. The pCRT7 NT TOPO vector contains a mutant pSer-containing... can follow her on Twitter @nieminm.   References 1. Cohen, Philip. "The origins of protein phosphorylation...contributed by guest blogger Natalie Niemi, a postdoctoral fellow at the Morgridge Institute for Research...

...type of choice in vitro is known as reprogramming [1]. The process can be divided into two stages: Dedifferentiation...//www.linkedin.com/in/kmukherjeephd/.  References 1. Hochedlinger, K. and R. Jaenisch, Nuclear reprogramming...from human peripheral blood. Cell Stem Cell, 2010. 7(1): p. 15-9. PubMed PMID: 20621044. PubMed Central PMCID...induced pluripotent stem cells. Hepatology, 2010. 51(1): p. 297-305. PubMed PMID: 19998274. PubMed Central... pluripotent stem cells. Nat Biotechnol, 2014. 32(1): p. 84-91. PubMed PMID: 24291815. PubMed Central ...keratinocyte lineage. Methods Mol Biol, 2014. 1195: p. 1-12. PubMed PMID: 24510784. PubMed Central PMCID: PMC4096605...induced pluripotent stem cells. PLoS One, 2010. 5(1): p. e8763. PubMed PMID: 20098701. 31. Tang, Z.H.,...

...your target gene! Tanenbaum et al., Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. Multi-bit genetic...light-sensitive LOV2 domain of Avena Sativa phototropin 1 (AsLOV2). In the dark, this peptide is caged by the...iLID nano and 800nM to 47µM for iLID micro; Figure 1). With this great affinity range, these LIDs have ...Figure 2). They are all available now at Addgene. 1 Lungu et al., Chem Biol. 2012 Apr 20;19(4):507-17....Guntas et al., Proc Natl Acad Sci USA 2015 Jan 6; 112(1):112-7. doi: 10.1073/pnas. CRISPR-Cas9 optogenetic... al., BMC Molecular Biology. 2013 August 20th; 14(1). TRICK: A method for visualizing the first round...for a variety of experimental purposes including (1) single or multiple, constitutive or inducible, gene...

...such as IL-8, IFNγ, and colony stimulating factor 1 (CSF-1). Additionally, tumor cells recruit regulatory...introduced the “Three Es of Immunoediting” nomenclature. 1. Eliminate - Latent tumors are recognized by effector...the tumor, activates hypoxia inducing factor (HIF-1), which promotes the production of VEGF to increase...This study used CRISPR gene editing to knockout PD-1 on immune cells harvested from patients and thereby...exploring new avenues in healthcare.   References 1. Vinay, Dass S., et al. "Immune evasion in cancer:...lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial." The Lancet 385.9967 (2015)...contributed by guest blogger Subhadra Jayaraman, a doctoral candidate at Binghamton University Cancer is one...

...in the immune system. Nature Immunology, 25(1), Article 1. https://doi.org/10.1038/s41590-023-01689-6 ... strains and lentiviral expression vectors (Table 1). The four systems Name Function Plasmid ... GFP (vex) Rosa26-FlpO-ERT2; H11-Cas9 Table 1: X-CHIME systems Proof of Concept These systems were...was lethal (LaFleur et al., 2024).   Figure 1: Schematic showing the X-CHIME approach. Figure from...genes in the immune system. Nature Communications, 10(1), 1668. https://doi.org/10.1038/s41467-019-09656-2... X-CHIME plasmids here!   Marty LaFleur is a Postdoctoral Fellow in Arlene Sharpe’s laboratory at Harvard...

...by mating with Cre-expressing mice. Figure 1: (A) Schematic of the Cre-dependent SPH construct ... alpha (aCaMKII; excitatory neurons) and Synapsin-1 (pan-neuronal) promoters (Figure 1b), and sgRNAs can...ubiquitous expression of sgRNA(s) and mCherry (vector 1) with neuron-specific expression of dCas9-VPR (Figure...Neuron-specific expression is mediated by the synapsin 1 (SYN) promoter, which was superior in its ability ...Patrick Miller-Rhodes, a Ruth L. Kirschstein NRSA Predoctoral Fellow at University of Rochester Medical Center...Miller-Rhodes is currently a Ruth L. Kirschstein NRSA Predoctoral Fellow at University of Rochester Medical Center...

...acceptable. Aims should be mechanistic, doable by 1-3 people in 1-5 years, and contribute to resolving the overarching...possible, do at least two full length practices (~1 h) and get feedback. It’s also helpful to practice...contributed by Erik Snapp, the Director of Student and Postdoctoral Programs at the Janelia Research Campus of the...from Oregon Health Sciences University, did his postdoctoral fellowship with Jennifer Lippincott-Schwartz...and now serves as the Director of Student and Postdoctoral Programs at the Janelia Research Campus of the...

...experiments or even negatively impact cells (see Figure 1). When behaving properly, FPs enable researchers ... disulfide bonds in the secretory pathway (Figure 1) [4,6–8]. Additionally, FPs that encode N-glycosylation... sarcoma-associated herpesvirus.       References 1. Snapp, Erik. "Design and use of fluorescent fusion...from Oregon Health Sciences University, did his postdoctoral fellowship with Jennifer Lippincott-Schwartz... from Albert Einstein College of Medicine. Her doctoral research was conducted in the laboratory of Erik...subcellular environment. Currently, she is a SPIRE postdoctoral fellow at the University of North Carolina at...

...digital) signal at the end of the reaction (Figure 1). Partitions that did not contain any target DNA at...integrated through homology-directed repair (HDR) (1), or indel mutations resulting from non-homologous...Follow him on Twitter @AnotherLabRat.     References 1. Miyaoka, Y. et al. Isolation of single-base genome-edited...This post was contributed by Scott Findlay, a Postdoctoral Fellow at the University of Alberta. If you’... out of frame! Scott Findlay is currently a Postdoctoral Fellow at the University of Alberta. He is interested...

...estimated to affect anywhere from 1 in 6,000 to 1 in 19,000 live births (1).  While disruption of the smn1... funding opportunities. References 1. Jones, C., et al. "PP09. 1–2352: Systematic review of incidence...Peritoneal Mesothelioma  Noushin Nabavi is a Postdoctoral Fellow at the Vancouver Prostate Center and ...

...Full "Applying for a Faculty Position" eBook Here 1. Have a competitive CV You don't necessarily need ...that people would agree is important to understand. (1-2 sentences). For example: Distinguishing correctly... What will be the focus of your first grant? (1-2 sentences) Simply stated, what are your aims... potential collaborations, critiques of your postdoctoral research, etc. The second question is whether...from Oregon Health Sciences University, did his postdoctoral fellowship with Jennifer Lippincott-Schwartz...and now serves as the Director of Student and Postdoctoral Programs at the Janelia Research Campus of the...

...aggregation, and potentiates the effect of PD-1 blockade.“ (Ref 4). PD-1 helps tumor cells evade the immune system...fasting has a positive effect on cancer treatment (Ref 1). As described in the presentation, starvation or ...of the immunosuppressive cell surface receptor PD-1. This immunosuppressive environment in turn may represent...  (Chimeric Antigen Receptors) CAR T cells and PD-1 modulators. An exciting development in immunotherapy...free deposit and distribution service! References: 1. Pietrocola, Federico, et al. "Caloric restriction...Relationship” by our guest blogger Subhadra Jayaraman, a doctoral candidate at Binghamton University! Cancer therapeutics...