Skip to main content
Addgene
Showing: 21 - 39 of 39 results

  2. Zhang Lab CRISPR Page

    Type
    Collection
    ...#60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes...#60226 - AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes...described here. #60227 - AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes...NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes...genome. #60229 - AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two expression cassettes...#60230 - AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid enables Cre/loxP recombination...AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR This plasmid facilitates Cre/loxP recombination...

  3. Cre-lox system

    Type
    Collection
    ...60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Cre, luciferase, and sgRNA expression ... Zhang 60229 AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR Cre and sgRNA coexpression Cbh AAV Zhang...AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR Cre, KASH-tagged EGFP, and sgRNA expression...70120 pEMS2159 iCre with MCS for inserting promoter, WPRE none AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro...fabp10 Zebrafish Stainier 85040 pK170.AAV-TRE-Cre-WPRE (Supernova) TRE-Cre based Supernova TRE AAV ... falxiparum Spielmann 86641 pLenti-hSynapsin-Cre-WPRE Cre hSyn Lentiviral Wang 86794 pCL20c-MSCV-IRES-...Mammalian Hirrlinger 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE mCherry and Cre; expressed in neurons hSyn AAV Yang...

  4. Brain Initiative Collection

    Type
    Collection
    ...Jonathan Ting 172907-AAV1 pGP-AAV-syn-FLEX-Volton2-ST-WPRE AAV-mediated expression of voltage sensor under ...172908-AAV1 pGP-AAV-syn-FLEX-Ace2N-4AA-mNeon-ST A122D WPRE AAV-mediated expression of voltage sensor under ...Mark Histed 179459-AAV1 pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE Double floxed soma and AIS-localized genetically...Francois St-Pierre 179460-AAV1 pAAV-EF1a-DIO-JEDI-2P-WPRE Double floxed genetically encoded voltage indicator...Francois St-Pierre 179463-AAV9 pAAV-hSyn-JEDI-2P-Kv-WPRE Soma and AIS-localized genetically encoded voltage...Francois St-Pierre 179464-AAV9 pAAV-hSyn-JEDI-2P-WPRE Genetically encoded voltage indicator (GEVI) JEDI...Francois St-Pierre 198513-AAV1 pAAV_hSyn-PdCO-EGFP-WPRE Expresses optimized PdCO in frame with EGFP under...

  5. Recombinases AAV Preps

    Type
    Collection
    ...none 1, 2, rg* Deisseroth 87306 AAV pEF1a-DIO-FLPo-WPRE-hGHpA EF1a none 1, 2, 5, 8, 9, rg* Zhang 75469 pAAV-EF1a-Flp-DOG-NW...Syn none 9 Wilson 107312 AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato....eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn none...CaMKII Promoter 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII..., 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson EF1a Promoter ... EF1a none 1 Cepko GFAP Promoter 105550 pAAV.GFAP.Cre.WPRE.hGH GFAP none 5, PHPeB Wilson GfaABC1D Promoter...

  6. Control AAV Preps

    Type
    Collection
    ...9, rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...Constitutive 8 Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng...1, 2, 5, 8, 9, rg* Roth 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP Cre dependent 1, 2, 5, 8, 9, rg* Zeng 59331...pENN.AAV.CamKII0.4.eGFP.WPRE.rBG CamKII EGFP Constitutive 1, 5, 9 Wilson 105535 pAAV.TBG.PI.eGFP.WPRE.bGH TBG EGFP...105549 pAAV.GFAP.eGFP.WPRE.hGH GFAP EGFP Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn..., rg*, PHP.eB Gradinaru 100896 pAAV.GFA104.PI.eGFP.WPRE.bGH GFA104 EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP...NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive 1, 2, 5, 8, 9, rh10...

  7. Lentiviral Prep Service

    Type
    Collection
    ...resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE) Zhang 61426 lenti MS2-P65-HSF1_Hygro MS2-P65-HSF1...Hygro resistance marker (EF1a-MS2-p65-HSF1-2A-Hygro-WPRE) Zhang Pooled Barcoding Libraries ID Name Description...

  8. AAV Molecular Tools

    Type
    Collection
    ...PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

  9. Luciferase Plasmids

    Type
    Collection
    ...60226 AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR Renilla EF1α AAV9-CRISPR knockout plasmid...Bruchez 108542 pLenti-EF1a-Luciferase-IRES-Blast-WPRE Firefly EF1α Lentiviral expression of firefly luciferase...viral transfection Sidi Chen 118412 ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293 Firefly EF1α AAV expression of firefly...

  10. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...pyogenes Joung AAV:ITR-U6-sgRNA (Backbone) PCB-FlPO-WPRE-syntetisk pA-UTR 68347 Mammalian/AAV none S. pyogenes...mCherry Kuhn AAV:ITR-U6-sgRNA(backbone)-pCBh-Cre-WPRE-hGHpA-ITR 60229 Mammalian/AAV SapI none S. pyogenes...AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR 60231 Mammalian/AAV SapI none S. pyogenes...Zhang AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR 60226 Mammalian/AAV SapI none S. pyogenes...

  11. Retrovirus Plasmids

    Type
    Collection
    ...GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression plasmid; deletion...

  12. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ... Express gene of interest from the CMV promoter. WPRE has been removed to increase the cloning capacity...

  13. Sequencing Primers

    Type
    Guide
    ...) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end of WPRE, reverse primer XBG-R GACTCCATTCGGGTGTTC...

  14. Retrovirus Guide

    Type
    Guide
    ...cis RNA target site for packaging by Nucleocapsid. WPRE in cis Woodchuck hepatitis virus post‐transcriptional...

  15. Chemogenetics Plasmids

    Type
    Collection
    ...rM3D (Gs) CMV No Roth 70717 AAV-mOXT-hM3Dq-mCherry-WPRE hM3D (Gq) Mouse Oxycotin mCherry No Geschwind 66795... Fishell 154867 pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA hM4D (Gi) Syn mCherry Flp-dependent Gether 154869...154869 pAAV-hSyn-fDIO-rM3D(Gs)-mCherry-WPREpA rM3D (Gs) Syn mCherry Flp-dependent Gether 154868 pAAV-hSyn-fDIO-hM3D...pAAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA hM3D (Gq) Syn mCherry Flp-dependent Gether 89150 pOTTC1329 - pAAV EF1a...

  16. Lentiviral Guide

    Type
    Guide
    ...Element; sequence to which the Rev protein binds. WPRE in cis Woodchuck hepatitis virus post‐transcriptional...

  17. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...cPPT PGK EGFP WPRE LTR H1 shSOD1 SOD1 H1 ALS Patrick Aebischer 10881 pCCL cPPT PGK EGFP WPRE LTR H1 shSOD1mismatch...pAAV-hSyn-Htt171-66Q-myc-WPRE HTT hSyn1 Huntington's Johan Jakobsson 107936 pAAV-hSyn-Htt171-18Q-myc-WPRE HTT hSyn1 ...Alzheimer's Andrew Deans 137187 pAAV FLEX eGFP 2A Tau WT WPRE MAPT CBA Parkinson's, FTD Matthew Nolan 138134 pT7NT...Pietro De Camilli 194242 pAM/SAR-CAG-aSyn(A53T)/HA-WPRE-bGHpA SNCA HA SAR-CAG Parkinson's Michael J Fox ...Foundation MJFF 194247 pAM/CBA-eGFP-miRaSyn(human)x3-WPRE-bGHpA SNCA GFP CAG Parkinson's Michael J Fox Foundation...Foundation MJFF 194248 pAM/CBA-eGFP-miRaSyn(mouse)x3-WPRE-bGHpA SNCA GFP CAG Parkinson's Michael J Fox Foundation...Fox Foundation MJFF 194244 pscAAV-CBh-aSyn-WPRE3-enSV40pA SNCA CBh Parkinson's Michael J Fox Foundation ...

  18. Brain Armamentarium

    Type
    Collection
    ...Capsid) 163505-PHPeB CN1390-rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA DLX2.0 (3xCore version of DLX enhancer). AAV...Gradinaru 163509-PHPeB CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA AAV vector for nuclear SYFP2 labeling in neurons...164450-PHPeB CN1851-rAAV-hI56i-minBglobin-iCre-4X2C-WPRE3-BGHpA AAV vector for Cre expression in forebrain...PHPeB AiP13038 - pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3038) Expression of SYFP2 (yellow...191728-PHPeB AiP12408 - pAAV-AiE0600m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2408) Expression of SYFP2 (yellow...PHPeB AiP13044 - pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3044) Optimized expression of SYFP2...199773-PHPeB AiP13863 - pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3863) Enhancer AAV for expression...

  19. Chemogenetics AAV Preps

    Type
    Collection
    ...rg* Roth 154867 pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA hM4D(Gi) - Inhibition mCherry fusion Flp-dependent...* Gether 154868 pAAV-hSyn-fDIO-hM3D(Gq)-mCherry-WPREpA hM3D(Gq) - Activation mCherry fusion Flp-dependent...
Showing: 21 - 39 of 39 results